ID: 917740662

View in Genome Browser
Species Human (GRCh38)
Location 1:177959109-177959131
Sequence GGTAATGAGTCTATAGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917740662 Original CRISPR GGTAATGAGTCTATAGCTAT AGG Intronic
902631496 1:17707195-17707217 GGTATTGAGTCCATAGCCCTGGG - Intergenic
909922209 1:81396241-81396263 GGTAATGATTTTGTAGCTATTGG + Intronic
911797738 1:102095454-102095476 GGTGATGGGGCTATAGTTATGGG - Intergenic
912129419 1:106583007-106583029 GGTAATTAGTCTATCACCATTGG + Intergenic
913298621 1:117346584-117346606 GGTAATGAGTCAAAAGCACTGGG - Intergenic
914806092 1:150992994-150993016 GGTAATGAGTCTAAATGAATTGG + Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
919220870 1:194626639-194626661 GGTAAAGAGTCAAGACCTATTGG + Intergenic
1062798410 10:361458-361480 TGTAATGACTCCATAGCTACAGG - Intronic
1067513276 10:46912905-46912927 GGAAAAGAGTCTATTGGTATAGG + Intronic
1067648976 10:48138937-48138959 GGAAAAGAGTCTATTGGTATAGG - Intergenic
1069116452 10:64512756-64512778 GATAATGAGTATAGTGCTATTGG - Intergenic
1072601413 10:96934415-96934437 GCTTATGACTCTATAGCTCTAGG - Intronic
1079579169 11:22040900-22040922 TGTAATAAGTCTGTAGCTTTTGG - Intergenic
1080010421 11:27453419-27453441 GATAATTAGTCAATATCTATAGG - Intronic
1097333297 12:58355589-58355611 GGGAATGAGTATATGGCTATAGG + Intergenic
1103204013 12:119114150-119114172 GGTAATGAGGCACTGGCTATAGG + Intronic
1112882664 13:104127087-104127109 GGTAATAAGTTTATAACTGTAGG + Intergenic
1116760347 14:49005446-49005468 TGTACTGAGTCTACAGCTGTGGG + Intergenic
1129056724 15:72825769-72825791 GCCAATGAGACTATAGCTAAGGG - Intergenic
1134024801 16:10945456-10945478 GGGAATGACTCTACAGCTCTGGG + Intronic
1136373550 16:29850909-29850931 GGAAATGAGTCCAGAGCTCTTGG - Intergenic
1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG + Intergenic
929344709 2:40867218-40867240 GGTAGGGATTCTGTAGCTATTGG - Intergenic
935423182 2:102891967-102891989 GGGAATGAGTATATGGATATAGG + Intergenic
936980502 2:118260726-118260748 GGTAATAAGTTTATTGCCATTGG + Intergenic
947282451 2:228470374-228470396 GGCAAAGAGTCTGGAGCTATGGG - Intergenic
1170971342 20:21119452-21119474 AGTAGTGAGTCTCTAGCTAGAGG + Intergenic
1173995024 20:47331390-47331412 GGGAATGAGTCCATATCTCTGGG + Intronic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1176597568 21:8761186-8761208 GGTAATGTGTCTAGAGCATTGGG + Intergenic
1177887041 21:26759868-26759890 GTTAATGATTCTAAAGCTCTGGG - Intergenic
1178319182 21:31591943-31591965 GGTGTTGAGTCTATTCCTATAGG + Intergenic
1180420876 22:12813652-12813674 GGTAATGTGTCTAGAGCGTTGGG - Intergenic
958118735 3:89256850-89256872 GGTAATGAATCTGAATCTATAGG + Intronic
963096115 3:141542763-141542785 GGTTATGACTATAAAGCTATGGG - Intronic
967361907 3:188640674-188640696 GGCAATGAGACTCTTGCTATGGG - Intronic
970548731 4:17157089-17157111 GGTAATTATTTTATATCTATAGG - Intergenic
970948069 4:21718781-21718803 AGTAATGACTCTATAGCCAATGG + Intronic
977747902 4:100573357-100573379 TGTAGTGAGTCTATAACAATTGG + Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999539562 5:152556807-152556829 GGGAATGAGACTAAAGCTTTAGG - Intergenic
1016686789 6:146891019-146891041 GGGAATGAGCCTATACCTACAGG - Intergenic
1018143812 6:160864471-160864493 GGTAGAGAGTCTATGGCTCTGGG - Intergenic
1027676649 7:81167439-81167461 GGTGAAGAATCTATAGCTATGGG + Intergenic
1030110342 7:106021508-106021530 GGTAATGAGTCTGGAGCCAGTGG + Intronic
1035897443 8:3419598-3419620 GGTTACGAATCTATAGCAATTGG - Intronic
1038390272 8:27191822-27191844 GGTAAGGTGTCTAAAGCTCTGGG - Intergenic
1038987263 8:32825595-32825617 GGTAATGGAGCTATAGCAATTGG - Intergenic
1045440960 8:102210338-102210360 TCTAGTGAGTCTATGGCTATTGG - Intronic
1054797744 9:69318209-69318231 GGAAATGTGTGTATAGGTATTGG + Intergenic
1060113124 9:120920701-120920723 GGTAATCAGTCCATGGCTCTGGG + Intronic
1203555728 Un_KI270743v1:206175-206197 GGTAATGTGTCTAGAGCATTGGG - Intergenic
1196181126 X:112690859-112690881 GGTATTAAGTCTATGGTTATTGG + Intergenic
1197359964 X:125489038-125489060 GGAAATGATTCTACAGCTTTTGG + Intergenic
1197374027 X:125660200-125660222 GGTACTGAGTTTATAGATCTAGG + Intergenic
1197951487 X:131902229-131902251 GGTAAGCAGTCTACAGTTATTGG + Intergenic
1198251533 X:134883748-134883770 GGATATGAGTACATAGCTATTGG - Intergenic