ID: 917741291

View in Genome Browser
Species Human (GRCh38)
Location 1:177964199-177964221
Sequence CTCCCTGGAAACAGCTCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917741282_917741291 26 Left 917741282 1:177964150-177964172 CCCCACGTCACTTTAGGTTACCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG 0: 1
1: 0
2: 3
3: 25
4: 286
917741283_917741291 25 Left 917741283 1:177964151-177964173 CCCACGTCACTTTAGGTTACCTT 0: 1
1: 0
2: 0
3: 6
4: 65
Right 917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG 0: 1
1: 0
2: 3
3: 25
4: 286
917741287_917741291 6 Left 917741287 1:177964170-177964192 CCTTATTTTTCTGGGCCTCAGCA 0: 1
1: 0
2: 1
3: 37
4: 517
Right 917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG 0: 1
1: 0
2: 3
3: 25
4: 286
917741284_917741291 24 Left 917741284 1:177964152-177964174 CCACGTCACTTTAGGTTACCTTA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG 0: 1
1: 0
2: 3
3: 25
4: 286
917741281_917741291 27 Left 917741281 1:177964149-177964171 CCCCCACGTCACTTTAGGTTACC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG 0: 1
1: 0
2: 3
3: 25
4: 286
917741290_917741291 -9 Left 917741290 1:177964185-177964207 CCTCAGCAAGCAGGCTCCCTGGA 0: 1
1: 0
2: 2
3: 28
4: 267
Right 917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG 0: 1
1: 0
2: 3
3: 25
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917741291 Original CRISPR CTCCCTGGAAACAGCTCCCC CGG Exonic
900154376 1:1198136-1198158 CTCCCTCAGAACAGCCCCCCAGG - Intergenic
900254572 1:1691358-1691380 CTGTCTGGGCACAGCTCCCCGGG + Exonic
900263324 1:1744633-1744655 CTGTCTGGGCACAGCTCCCCGGG + Intronic
900414319 1:2528085-2528107 CTCCCAGGGACCAGCTCCCAAGG - Intergenic
900484362 1:2914446-2914468 CTCCATGGAAGATGCTCCCCGGG - Intergenic
900786327 1:4653000-4653022 AGCCCTGCAAACACCTCCCCGGG + Intergenic
900895702 1:5481501-5481523 CTCCCTGGCCACAGCTCTCCTGG + Intergenic
901198150 1:7451791-7451813 CTCCCTGCCCTCAGCTCCCCTGG + Intronic
901506667 1:9689669-9689691 CTCCCTGGAGACAGTTGCCCAGG - Intronic
901608962 1:10481895-10481917 CTCACTGCAAACTGCTTCCCAGG + Intronic
901751771 1:11414369-11414391 CCTCCTAGAAATAGCTCCCCAGG - Intergenic
901783629 1:11610445-11610467 CACCCTTGAAAGAGCTACCCAGG + Intergenic
902273499 1:15323453-15323475 TTCCCGGGAAACAGCTCACTGGG + Intronic
902333700 1:15743068-15743090 CTCCCTGGAAACGGTGCACCTGG + Exonic
902444125 1:16451023-16451045 CACTCTGGAAACACCTCTCCTGG + Intronic
902656198 1:17870014-17870036 CACATTGGAAGCAGCTCCCCTGG - Intergenic
903181913 1:21609085-21609107 CTCCCTGGGCTCAGCTCCCCAGG + Intronic
903358297 1:22761690-22761712 CTCCCTGGCAACCCTTCCCCTGG + Intronic
904301924 1:29559722-29559744 CTTCCTGGGCAGAGCTCCCCAGG - Intergenic
904614619 1:31743124-31743146 CCCCCTGGCAACAGATCCCGGGG - Intronic
904970824 1:34418310-34418332 CTCCTTGGCATAAGCTCCCCTGG + Intergenic
906215130 1:44034087-44034109 CTCCCAGGAAATAGCTCCACTGG - Intergenic
906739183 1:48164699-48164721 CTCCTTAGAGACAGCTCCCATGG - Intergenic
906743759 1:48207428-48207450 CTCCTGGGCAGCAGCTCCCCAGG - Intergenic
906775789 1:48528351-48528373 CTCCCTGGCATCAGCTGCCTTGG - Intergenic
907714885 1:56917295-56917317 CTCCCTGGACAGAGCCCCCAGGG + Intronic
909612219 1:77563406-77563428 CTCCAAGGAAACAGCCCCCATGG - Intronic
909925211 1:81430422-81430444 CTAACTGGAAACAGATCCCCTGG - Intronic
915086656 1:153393968-153393990 CTCCCCAGAAACTGCGCCCCTGG + Intergenic
915948650 1:160172825-160172847 CTACCTGGAAACCACTGCCCAGG - Intronic
917149684 1:171930241-171930263 CTCCCTGGATAGAGCTCTGCGGG - Intronic
917259077 1:173148039-173148061 CTCCCTGGACAGAGCTTCCAGGG - Intergenic
917485997 1:175455153-175455175 CATCCTGGAAACAGATCCTCCGG + Intronic
917741291 1:177964199-177964221 CTCCCTGGAAACAGCTCCCCCGG + Exonic
919923703 1:202181427-202181449 CTCCCTGCACCCAGCTCCTCAGG - Intergenic
920190218 1:204189106-204189128 TACCCTTGAAACAGCTCTCCAGG - Intergenic
920398786 1:205664389-205664411 CTCCCTCCAAGCAGCTCCCAGGG + Intronic
920521577 1:206631402-206631424 CTCCCTGGGAACAGCTGCAAAGG + Intergenic
921177345 1:212606937-212606959 CGCCCTGGTAACGGCTCTCCGGG - Intronic
924938405 1:248791738-248791760 CTCCCAGGAAATGGCTCCTCAGG + Intergenic
1063066171 10:2611558-2611580 TTCGCTGGAAACAGGTCCACAGG - Intergenic
1063205952 10:3830649-3830671 ATCCCTGGAAGCAGCTCCCATGG + Intergenic
1063958845 10:11289558-11289580 CTCCCTCGAAACAATCCCCCAGG - Intronic
1065742927 10:28813273-28813295 CTCCCTGGCAAGAGATCCCAGGG - Intergenic
1069622508 10:69846488-69846510 CTCCCTGGATGCACCTTCCCGGG - Intronic
1070716598 10:78727033-78727055 TTCTCTGGAAACTGCTTCCCAGG - Intergenic
1072020068 10:91390458-91390480 CTCCCTGCAAACTGCCTCCCAGG + Intergenic
1073072920 10:100806121-100806143 CTCCCAGGAGCCAGCTCCCTGGG - Intronic
1073105276 10:101029350-101029372 GTCCCTTGTAACACCTCCCCAGG + Intronic
1074134996 10:110618295-110618317 CACCCTGGAGGCAGCTCTCCTGG + Intergenic
1074426622 10:113357132-113357154 CTAACTTGCAACAGCTCCCCTGG + Intergenic
1075426405 10:122345104-122345126 CTCTCTGGAAACAGTGCTCCAGG - Intergenic
1076507528 10:130987716-130987738 CTCCCTTGAAGAAGCTTCCCTGG - Intergenic
1076661485 10:132058534-132058556 CTCCCCGGAGGCCGCTCCCCTGG + Intergenic
1076849656 10:133086667-133086689 CTCCCTGGACACCGTTCCCTTGG - Intronic
1077059810 11:613167-613189 ACCCCTGGAGACAGCCCCCCAGG + Intronic
1077283059 11:1754203-1754225 CTCCCTGGGAGCCCCTCCCCTGG + Intronic
1077340246 11:2023208-2023230 CTGCCTGGACACAGACCCCCAGG - Intergenic
1077593602 11:3512465-3512487 CTCCGTGGTAACAGCTGCACTGG + Intergenic
1084025616 11:66447030-66447052 CTACCAGGAAGCAACTCCCCAGG + Intronic
1084249417 11:67885213-67885235 CTCCGTGGTAACAGCTGCACTGG + Intergenic
1084458868 11:69285226-69285248 CTCTCTGGACACACCTGCCCTGG + Intergenic
1084823382 11:71710280-71710302 CTCCGTGGTAACAGCTGCACTGG - Intergenic
1087007792 11:93486301-93486323 CTCCCTGGAAGCAGCTGCTTGGG - Intronic
1087351400 11:97037437-97037459 CTGAATGGAAACAACTCCCCTGG - Intergenic
1088886210 11:114009084-114009106 CTCCCTTGAAACTGCTCCAAAGG + Intergenic
1088903140 11:114133727-114133749 ATCCATGGAAATTGCTCCCCTGG + Intronic
1091319893 11:134641956-134641978 CTTTCTGGAAACAGCACCCAAGG + Intergenic
1202823231 11_KI270721v1_random:78397-78419 CTGCCTGGACACAGACCCCCAGG - Intergenic
1092039825 12:5374357-5374379 CTCCCTGGACACTCCTCCCAGGG - Intergenic
1092229173 12:6767186-6767208 CTCCCTGGAGGCTGCTCCTCCGG + Intronic
1092523920 12:9298063-9298085 CTCCCAGGAAAGGTCTCCCCAGG - Intergenic
1092543378 12:9433836-9433858 CTCCCAGGAAAGGTCTCCCCAGG + Intergenic
1096930172 12:55199311-55199333 CTCCCTGGAAACATCTCGAAAGG + Intergenic
1099719502 12:86342392-86342414 CTCCCTGGAAAGAGCCTCCAGGG + Intronic
1102813577 12:115844315-115844337 CTCCCTGGAACCACCTCCCCAGG + Intergenic
1103208505 12:119149432-119149454 CTCCCTGGAGACAGCTCCCTGGG - Intronic
1105836407 13:24216055-24216077 GTGACTGGCAACAGCTCCCCTGG + Intronic
1106199466 13:27524359-27524381 CTTCCTGGAGACATCTCCTCGGG - Intergenic
1106833479 13:33610460-33610482 CTCCCTGGGCACAGCACCGCAGG + Intergenic
1108753093 13:53468725-53468747 TTACCTGGGACCAGCTCCCCAGG - Intergenic
1109163399 13:59003883-59003905 CTCCCTGGGAACAGAGCACCTGG - Intergenic
1110696493 13:78497130-78497152 ATCCCTGGAGCCAGCTACCCTGG + Intergenic
1113226925 13:108169226-108169248 CTCCCTGGACAGAGTTCCCAAGG + Intergenic
1115648059 14:35384015-35384037 CTCTCCTGAAACTGCTCCCCAGG - Intergenic
1118725313 14:68624743-68624765 CTCTCAGGAAACAGGGCCCCAGG + Intronic
1118780434 14:69004311-69004333 TTCCCTGGAAGCAGCTCCGAGGG - Intergenic
1121994690 14:98593062-98593084 CTCCCTGCCAGCGGCTCCCCTGG + Intergenic
1121996342 14:98606442-98606464 CTCCCTGGCAAGGGCTCCTCAGG - Intergenic
1122084451 14:99290021-99290043 CTCCCTTGAAGCAGGTCCCGAGG + Intergenic
1122084764 14:99291885-99291907 CTCCCTGCAATATGCTCCCCAGG + Intergenic
1122134024 14:99622347-99622369 CTCTCTGGACAGAGCACCCCAGG - Intergenic
1122789053 14:104176750-104176772 CTCCGTGGGAGCATCTCCCCAGG - Exonic
1123135008 14:106019761-106019783 GTGTCTGGAGACAGCTCCCCAGG - Intergenic
1123585553 15:21757630-21757652 TTATCTGGAGACAGCTCCCCAGG - Intergenic
1123622194 15:22200218-22200240 TTATCTGGAGACAGCTCCCCAGG - Intergenic
1123964626 15:25442648-25442670 CCTCCTGGAAACTGCTCCCTTGG + Intergenic
1123982367 15:25615487-25615509 CTACCTGGAAATAGCCTCCCAGG + Intergenic
1124003323 15:25777398-25777420 CTCCCTGGCAATAGCCTCCCCGG + Intronic
1128358224 15:66943266-66943288 CTCTCTGAAAGCAGCTGCCCAGG + Intergenic
1128457694 15:67841503-67841525 CTCCCTGGCAGTGGCTCCCCAGG - Intergenic
1128657926 15:69476121-69476143 CTCCATGTAGACAGCTCTCCTGG - Intergenic
1129385220 15:75192526-75192548 CTGCCTGCGAACAGCTCCCCTGG - Intergenic
1130067249 15:80615077-80615099 CTCACTGGACACAGCTGCCTGGG - Intergenic
1130944899 15:88543605-88543627 CTCCGTGGTAACAGCTGCACCGG - Intronic
1131000545 15:88936527-88936549 CTCCCTGGCAGGAGCCCCCCAGG - Intergenic
1131374172 15:91909914-91909936 CACTGTGGAAACAGCTGCCCCGG + Intronic
1131562887 15:93459595-93459617 GTCCCTGGCATCAGCTCCCATGG - Intergenic
1135590363 16:23700827-23700849 CTCCCTCCCAGCAGCTCCCCAGG - Intronic
1136995722 16:35187055-35187077 CACCCTGGGATCTGCTCCCCAGG - Intergenic
1137611000 16:49817483-49817505 CTTCCTGGAAAGTCCTCCCCAGG - Intronic
1137686540 16:50390674-50390696 CTCGCTGGAAACCGCTGCCGAGG + Intergenic
1138321178 16:56113429-56113451 CTTCATGCAAACAGCTTCCCAGG - Intergenic
1139286903 16:65823504-65823526 CTCCCTTGAAAGAACTGCCCTGG - Intergenic
1140196058 16:72856563-72856585 CCACCTGGAGACAGCTGCCCAGG + Intronic
1141135745 16:81464031-81464053 CTGCCTGGAAAAAGCCACCCCGG - Intronic
1141829260 16:86500543-86500565 CTGCCTGGGACCACCTCCCCGGG - Intergenic
1141906091 16:87027990-87028012 ATCCATGGTAACAGGTCCCCAGG - Intergenic
1142032239 16:87844370-87844392 TTCCCTGAAATCATCTCCCCAGG - Intronic
1142279473 16:89140246-89140268 CTCCCTGCAGCCACCTCCCCTGG + Intronic
1142431616 16:90031543-90031565 CTCACTGGATCCAGCTCCTCTGG - Intronic
1143084446 17:4405501-4405523 CTAGCTGCAAACAGATCCCCTGG + Intergenic
1144358794 17:14471104-14471126 CTGCTTGGAAACTGCTTCCCAGG - Intergenic
1145864120 17:28229120-28229142 CTGCTTGGACACAGGTCCCCAGG + Intergenic
1145996349 17:29106977-29106999 TTCCCTGGAGACAGCTCATCTGG - Intronic
1146475936 17:33162807-33162829 CTTCCTGGTAGCAGCTCCCCTGG + Intronic
1147484269 17:40797081-40797103 CTCCCTGCTCACACCTCCCCGGG - Intronic
1148350605 17:46939314-46939336 TTCCCTGGAAGCAGCTACCTAGG + Intronic
1148794482 17:50190477-50190499 CTCCCTTCACACAGCACCCCTGG - Intronic
1149271496 17:54983394-54983416 CTAACTGGACACAGGTCCCCAGG - Intronic
1150005272 17:61465186-61465208 CTCCCTGTGAACACCTCACCTGG - Intronic
1151375289 17:73684355-73684377 CTCCCAAGAAAAAGCTCCCACGG - Intergenic
1151444799 17:74156236-74156258 CTCCCAGGAGGCAGCTCCCCTGG + Intergenic
1151480667 17:74368589-74368611 CCCCCTGGAATCACCTCCCATGG - Intronic
1152274851 17:79350172-79350194 CTCCCTGGCTGCAGCTGCCCTGG + Intronic
1152463127 17:80451578-80451600 CCACCTGGAAACAGCCCCCCAGG - Intergenic
1152533630 17:80937619-80937641 CTCCCTGTAAACAGAGCTCCTGG - Intronic
1152644840 17:81463977-81463999 TTCCCTGGAAAGAGCGCTCCAGG + Exonic
1153724081 18:7937363-7937385 CTCCCTGCAAGCAGCTTCCAAGG - Intronic
1153785374 18:8529326-8529348 CTCCCTGGAAAGAGCCTCCAGGG + Intergenic
1156279790 18:35625730-35625752 CTTCCCAGAAACTGCTCCCCTGG + Intronic
1156360247 18:36378406-36378428 CTCCCAGGAGACAGATCCCAAGG + Intronic
1156369541 18:36460494-36460516 CTCCCTGGAAAAAGGACCTCCGG - Intronic
1156446521 18:37241272-37241294 CTCTCTGGTGACAGCTCCCAGGG + Intergenic
1156464893 18:37342569-37342591 CAGACTGGAAACAGCTCCACTGG + Intronic
1157333354 18:46719600-46719622 CTGCCAAGAAACAGCTTCCCAGG + Intronic
1158239164 18:55357752-55357774 CTCCCTGGAAACAGGAACCAGGG + Intronic
1159935231 18:74360402-74360424 CTCCACGGAAACTGCTCCTCAGG - Intergenic
1160020730 18:75178755-75178777 CTCCCGGGCAAGGGCTCCCCTGG + Intergenic
1160840803 19:1146337-1146359 GGCCCTGCAAACAGCTCGCCGGG - Intronic
1160868857 19:1267995-1268017 GTCACTGGAGACAGCGCCCCTGG + Intronic
1160917549 19:1504382-1504404 CACCCTGGGAACCCCTCCCCAGG - Intergenic
1161033621 19:2071785-2071807 CTCCCTGGACGCCTCTCCCCTGG - Exonic
1161405478 19:4089027-4089049 CCTCCTGCAAACAGCTCCCCAGG - Intergenic
1163048178 19:14660770-14660792 CTCCCTGGACACGGATCCACGGG + Intronic
1163549163 19:17955831-17955853 CTCGCTGGAGACAGCCCCCAGGG + Intronic
1164219712 19:23182532-23182554 CTCCGTGGTAACAGCTGCACCGG + Intergenic
1164824066 19:31271388-31271410 CTCCCTGGAAACAAAACCCTGGG + Intergenic
1165333900 19:35155799-35155821 CTCACTGGAAGCAGCCACCCGGG - Intronic
1165522677 19:36327085-36327107 CTCCATGGTAACAGCTGCACCGG + Intergenic
1165658275 19:37551690-37551712 CTCCCCGGAGACAGCAGCCCCGG - Intronic
1165658912 19:37557529-37557551 CTCCGTGGTAACAGCTGCACCGG + Intronic
1165975467 19:39672569-39672591 CTCCCTGAAAACGGATCTCCGGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1168657587 19:58141983-58142005 CTCACTGCAAACTGCTTCCCAGG - Intronic
925610397 2:5696842-5696864 TGCCCCGGAATCAGCTCCCCGGG + Exonic
927800020 2:26090029-26090051 CTCCCAGGAAAAATCCCCCCTGG + Intronic
927884338 2:26709448-26709470 CTCTCTGGAAACACTCCCCCTGG - Intronic
928462162 2:31485194-31485216 CTCCCTGGACACAGCCCCCAGGG - Intergenic
929028119 2:37625202-37625224 CTTCCTGGAAACAGTCTCCCTGG + Intergenic
929555045 2:42920819-42920841 CTCCCTGCACGCAGCTCACCTGG - Intergenic
930028447 2:47044017-47044039 CTCCCTGGGGACAGCTCCCTGGG - Intronic
931236127 2:60413850-60413872 CTCCCTGGAAACAGATGTCTTGG + Intergenic
931392437 2:61855303-61855325 CTGACTGGAAATTGCTCCCCTGG - Intergenic
932405076 2:71507258-71507280 GACCTTGGAAACAGGTCCCCTGG - Intronic
933212396 2:79585852-79585874 CACCCCGGAAACAGCACCCAGGG - Intronic
936154567 2:110039801-110039823 CTGCCTGGAGACAGTTCCCAGGG + Intergenic
936190116 2:110331613-110331635 CTGCCTGGAGACAGTTCCCAGGG - Intergenic
937283329 2:120735455-120735477 CGCCCTGGGAACAGCGACCCAGG + Intergenic
939436143 2:142180697-142180719 GTCCCTGGGCACAGGTCCCCGGG - Intergenic
940726413 2:157341456-157341478 CCCACTGGAACCAGCTCACCCGG - Intergenic
942588367 2:177511621-177511643 CTCCCTGAAAAAAACTTCCCTGG - Intronic
942964816 2:181879126-181879148 TTCCCTGAAAACTGCTCCACTGG + Intergenic
943715749 2:191150738-191150760 CTCCGCGGAAACCGCTCCGCAGG - Intronic
947549073 2:231033556-231033578 CTCCCTCCACCCAGCTCCCCAGG + Intergenic
948482614 2:238259684-238259706 CACACTGGTCACAGCTCCCCAGG + Intronic
948857545 2:240737028-240737050 CTCCCTGGAGACAGGGCCCAGGG - Intronic
1168832706 20:855548-855570 CTCCCAGGAACGAACTCCCCTGG - Intronic
1168985940 20:2049295-2049317 CTCCCTGTGAGTAGCTCCCCAGG + Intergenic
1174048933 20:47754022-47754044 GGCCCTGGAAGCAGTTCCCCTGG + Intronic
1174581282 20:51573678-51573700 CACTCTGGATACAGCTCCCCAGG - Intergenic
1175186391 20:57182026-57182048 CCCCCGGGCAGCAGCTCCCCTGG + Intronic
1175271619 20:57737936-57737958 CTCCCTGGAAACAACTTTCCAGG - Intergenic
1179362567 21:40726106-40726128 TTTCCTGGAAACATCTCTCCAGG - Intronic
1180102454 21:45595192-45595214 CTCCCTGGAGACGGCACCACTGG - Intergenic
1180141474 21:45896004-45896026 CTCCCTGGAGACCTCTCCCAAGG + Intronic
1180739050 22:18040504-18040526 CTCCCATTAAACAGCTTCCCCGG - Intergenic
1180957076 22:19745942-19745964 CTCCCTGGAAACATCCTGCCTGG - Intergenic
1181422848 22:22813844-22813866 CTCCCTGGGACCAGCTGCCTAGG - Intronic
1183075933 22:35426707-35426729 CTTCCTGGGAGCACCTCCCCGGG - Intergenic
1183404892 22:37625633-37625655 CTGCCTGGAAACTGCTCAACAGG - Intronic
1184175217 22:42785189-42785211 CTCCCTGTGAACAGCTTCCAGGG - Intergenic
1184420691 22:44381313-44381335 CTTTGTGGAAACAGCTGCCCTGG + Intergenic
1184456883 22:44615993-44616015 CTCCCTGGAAGCCGGGCCCCTGG - Intergenic
949509273 3:4754189-4754211 ATCTCTGGAAACAACTCCCCAGG - Intronic
951415097 3:22414172-22414194 CTCCCTGGGAACAGAGCACCTGG - Intergenic
952898407 3:38094423-38094445 CTTTCTGGACACAGCTCTCCTGG + Intronic
953440981 3:42917160-42917182 CTCTCTGGGAACAGTTACCCGGG + Intronic
953903252 3:46855036-46855058 CTCCCTGGAATCACCTTCCAGGG + Intergenic
959228262 3:103614749-103614771 CTTCCTGTAAACATCTGCCCTGG + Intergenic
959688667 3:109175579-109175601 CTCCCAGAATACAGCTCCACAGG - Intergenic
960157192 3:114307984-114308006 CTGCCTGGACACAGCTTCCTGGG - Exonic
960844821 3:121995655-121995677 CTCCCTGAAGACAGGTCCACAGG + Intronic
960954301 3:123020939-123020961 CTCCCTTTCAACAGCTCTCCAGG - Intronic
961289712 3:125836195-125836217 CTCCATGGTAACAGCTGCACTGG - Intergenic
961897395 3:130179800-130179822 CTCCGTGGTAACAGCTGCACTGG + Intergenic
962755281 3:138461419-138461441 CCCACTGGACACACCTCCCCAGG + Intronic
962926004 3:139993938-139993960 CTCCCAGAAAATAGCTCCCAAGG - Intronic
964893616 3:161567093-161567115 CTCCATTGAAATAGCTACCCTGG - Intergenic
966917680 3:184593906-184593928 CTCCCTAGAAAGCGCTCCCTGGG - Intronic
967692826 3:192496683-192496705 CTCCGTCGAAACTGCTCACCAGG + Intronic
970581423 4:17477459-17477481 CTCGGTGGAAGCAGCTCCCCAGG - Intronic
971184844 4:24364421-24364443 CTCCCTGGAAGCAGCTTGACAGG - Intergenic
973773625 4:54227211-54227233 ATCCCTGGAGTCAGCTCCTCAGG + Intronic
974657875 4:64848736-64848758 CTCCCTGTAACTAGGTCCCCTGG - Intergenic
974894966 4:67927377-67927399 CTCACTGCAAGCAGCTTCCCTGG - Intronic
976221685 4:82761423-82761445 CTCCATGGAAACAGCTCAGCTGG - Intronic
976779087 4:88738598-88738620 CTCCCTGGACACAATTCCCAAGG + Intronic
977961540 4:103090695-103090717 CTGCCTGGAATCATCTCCCAAGG + Intronic
982775385 4:159436212-159436234 GTCCCTGGAAACTTCTCCCTGGG + Intergenic
984962408 4:185110661-185110683 CTGCCAGGAAACAGCGCCACAGG - Intergenic
985095990 4:186413819-186413841 CTCCTTGAACACAGCTTCCCTGG - Intergenic
985768293 5:1793356-1793378 CTGCCAGGAGGCAGCTCCCCTGG - Intergenic
986569845 5:9153577-9153599 GTCCTTGGCACCAGCTCCCCTGG - Intronic
986934751 5:12869083-12869105 TTCCCTGGGAAAAGCTCTCCAGG + Intergenic
986996286 5:13611167-13611189 CTCTCTGGCAACAACTCCCAAGG + Intergenic
988949171 5:36241074-36241096 CGCCCTGCGAACAGCTCCCCTGG - Intronic
990516200 5:56533123-56533145 CTCCATGGAAAGAGCCCACCTGG + Exonic
990742068 5:58922550-58922572 CTCCCTGGTGGCAGCTGCCCGGG - Intergenic
990989906 5:61674644-61674666 CTCCCTGGAAACAGAACAGCAGG - Intronic
991661344 5:68953961-68953983 TTCCCTAGAGACAGCTCCCTTGG + Intergenic
991960014 5:72035048-72035070 CTCAGTGCAGACAGCTCCCCAGG + Intergenic
993351270 5:86853272-86853294 CTCCCTGGACAGAGCCCCCAGGG - Intergenic
994081152 5:95710129-95710151 CTCCATGGTAACAGCTGCACCGG + Intergenic
997353894 5:133249923-133249945 CGCCCTGCTCACAGCTCCCCTGG + Intronic
997978219 5:138452868-138452890 CTGCATGTAAACAGCTCTCCAGG + Intergenic
998415318 5:141941687-141941709 CTCCCTGAAAACAGCATCTCCGG - Exonic
1001553165 5:172618838-172618860 CTTTCTGGAAACAGCTAGCCCGG + Intergenic
1001900061 5:175419776-175419798 CACCCTGGAAACAGCCTCTCTGG + Intergenic
1002044809 5:176536016-176536038 CTTCCTGCAAACAGATCCCTGGG - Intronic
1002419773 5:179139511-179139533 CTGGCTGCAAACAGCTGCCCAGG + Intronic
1002424864 5:179168958-179168980 CTCTCTGGGAATAGCTTCCCAGG - Intronic
1003698262 6:8435158-8435180 CTCCCTGGAAACCGCCCGGCCGG + Exonic
1006162449 6:32046448-32046470 CTCCCTCTGCACAGCTCCCCTGG - Intronic
1006598996 6:35213651-35213673 CTCCATGGAGACGGCTTCCCCGG - Intergenic
1007785534 6:44277249-44277271 CACCCTGGCAACAGCTCTGCAGG - Exonic
1007973853 6:46080253-46080275 CTCCCTGTAAACAGATCTCTCGG - Exonic
1013479210 6:110538654-110538676 CTTCCTGCAGACAGCTTCCCTGG - Intergenic
1013709796 6:112883381-112883403 TTCCCTGAAAACAGCTGCCATGG + Intergenic
1015599058 6:134894648-134894670 CTCCCTGGAAACCACTCACTGGG + Intergenic
1016845967 6:148568993-148569015 CTCCCTGGACTGAGCTCCCAGGG - Intergenic
1017971368 6:159315276-159315298 CTGCCTGGAAGGAGCTCCCCAGG + Intergenic
1018866274 6:167748869-167748891 CACGCTGCAACCAGCTCCCCAGG + Intergenic
1019216469 6:170447110-170447132 CCCCATGGTAAGAGCTCCCCGGG - Intergenic
1020126255 7:5533974-5533996 CTCCCTGGTAAAGGGTCCCCTGG + Intronic
1021175831 7:17449178-17449200 CTCCCTGGACAGAGCACCCTGGG - Intergenic
1022698038 7:32728780-32728802 CCCCCAGGAAACAGCTGCGCGGG - Intergenic
1023012727 7:35938119-35938141 CTCCATGGAAACCACTGCCCAGG - Intergenic
1023163869 7:37324054-37324076 CTTCCTGGAAGCACCTTCCCAGG + Intronic
1024078403 7:45835728-45835750 CTCCATGGAAACCGCTGCCCAGG + Intergenic
1026508979 7:71012002-71012024 CTCACTGAAAACTGCTTCCCAGG + Intergenic
1029556990 7:101277161-101277183 CTCCATGGAAACCGCTGCCCAGG - Intergenic
1030299295 7:107959403-107959425 CTCCCTGGAAACAGTGGCACTGG + Exonic
1032265619 7:130368122-130368144 CTGCCAAGAAACAGCTCCCTGGG - Intronic
1032360509 7:131250510-131250532 CTCCATGGAAACAGCTTGTCAGG - Intronic
1033527953 7:142234906-142234928 GGTCCTGGAACCAGCTCCCCAGG + Intergenic
1035327857 7:158076393-158076415 CTCCCATGCACCAGCTCCCCAGG - Intronic
1035337320 7:158138293-158138315 CTCCGTGGAGACAGCTTTCCAGG - Exonic
1035339697 7:158152365-158152387 CTGCCTGAAGACAGCTTCCCAGG - Intronic
1036368548 8:8142610-8142632 CTCCGTGGTAACAGCTGCACTGG - Intergenic
1036882339 8:12523032-12523054 CTCCGTGGTAACAGCTGCACTGG + Intergenic
1036953056 8:13159757-13159779 CTCCCTGGAAGAACATCCCCAGG - Intronic
1040380564 8:46868098-46868120 CTCCCTGGACAGAGCTTCCAGGG + Intergenic
1041009897 8:53531399-53531421 CTCCTAGGAAGCAGCTCCCCAGG + Intergenic
1041083456 8:54235172-54235194 CACCCTGGAAACATCTCCCCAGG - Intergenic
1043514659 8:80985007-80985029 CTGCCTCGAAAGAGCTCCCAGGG - Exonic
1045189555 8:99869311-99869333 CTCCCTAGAAACACATCCCATGG - Intronic
1046349871 8:112993802-112993824 CTTTCTGGAAAAAGGTCCCCTGG - Intronic
1048689335 8:136942293-136942315 CTTCCTGGAATTATCTCCCCTGG + Intergenic
1049357854 8:142197558-142197580 CTCCCTATAAGCAGCTGCCCTGG - Intergenic
1049647006 8:143739984-143740006 CCCCCTGCCAACAGCTCACCCGG - Intergenic
1050074198 9:1846833-1846855 CTTCCATGAAACAGTTCCCCTGG - Intergenic
1050180156 9:2913683-2913705 CCTCCTGTAAACAGCTGCCCAGG + Intergenic
1050562358 9:6847470-6847492 CTCACTGCAAACACCTCCCGGGG + Intronic
1057177602 9:93011125-93011147 CTCTCTGGAGGCAGCTGCCCTGG + Intronic
1058621070 9:106883760-106883782 CTACCTGGAATCAGCAGCCCTGG + Intronic
1058846803 9:108968592-108968614 CTCCCAGTAAACAGATCCCTTGG + Intronic
1060992350 9:127856401-127856423 CTCCCTGGATCCACCTGCCCTGG + Intergenic
1061002581 9:127910648-127910670 CTCCCTGGAGGCAGCAGCCCTGG + Intronic
1061508370 9:131045671-131045693 CTCCCTGCAAACGCCTCCCAAGG + Intronic
1062316568 9:135970238-135970260 TTCCCTGGGAGCAGCTTCCCAGG + Intergenic
1062570655 9:137183602-137183624 CTCCCTGGACATGGGTCCCCTGG + Intronic
1062579354 9:137222564-137222586 GGCCCTGGAACCAGCTCCCCTGG - Intergenic
1188479452 X:30622297-30622319 CTCCCTGTAAACATCTTCCTGGG - Intergenic
1188715006 X:33449584-33449606 CTTCCTGGACACAGCCCCCAGGG + Intergenic
1189323341 X:40098761-40098783 CTACCTGAAAACACCACCCCAGG + Intronic
1190336658 X:49266823-49266845 ATCACTAGAATCAGCTCCCCAGG - Intergenic
1195197762 X:102516430-102516452 GTCCCTGGAAACAAGGCCCCGGG - Intronic
1196152653 X:112392184-112392206 CTCCCTGGACAGAGCCCCCAGGG - Intergenic
1199643594 X:149884563-149884585 CTCCCCGGACCCAGCTCACCTGG + Exonic
1199834068 X:151571087-151571109 CTTCCTGGAAACACCTAACCTGG - Intronic
1201729254 Y:17187501-17187523 CTCCCTGGGAACCGGTCCCCAGG + Intergenic
1202269191 Y:23053949-23053971 CTCCATGGACACAGCTTCCAGGG - Intergenic
1202422183 Y:24687689-24687711 CTCCATGGACACAGCTTCCAGGG - Intergenic
1202448603 Y:24982389-24982411 CTCCATGGACACAGCTTCCAGGG + Intergenic