ID: 917743162

View in Genome Browser
Species Human (GRCh38)
Location 1:177981424-177981446
Sequence GAAAGAAGGATGTTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917743155_917743162 28 Left 917743155 1:177981373-177981395 CCAGAGACATTCCAAAAAGCAGG 0: 1
1: 0
2: 1
3: 15
4: 232
Right 917743162 1:177981424-177981446 GAAAGAAGGATGTTTCTCACTGG 0: 1
1: 0
2: 0
3: 40
4: 198
917743160_917743162 2 Left 917743160 1:177981399-177981421 CCGGAACTTATGCTTGAACTACT 0: 1
1: 0
2: 0
3: 9
4: 105
Right 917743162 1:177981424-177981446 GAAAGAAGGATGTTTCTCACTGG 0: 1
1: 0
2: 0
3: 40
4: 198
917743159_917743162 3 Left 917743159 1:177981398-177981420 CCCGGAACTTATGCTTGAACTAC 0: 1
1: 0
2: 1
3: 13
4: 110
Right 917743162 1:177981424-177981446 GAAAGAAGGATGTTTCTCACTGG 0: 1
1: 0
2: 0
3: 40
4: 198
917743158_917743162 17 Left 917743158 1:177981384-177981406 CCAAAAAGCAGGCACCCGGAACT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 917743162 1:177981424-177981446 GAAAGAAGGATGTTTCTCACTGG 0: 1
1: 0
2: 0
3: 40
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917743162 Original CRISPR GAAAGAAGGATGTTTCTCAC TGG Intronic
902400540 1:16154777-16154799 AAAAGAAGGAAACTTCTCACCGG + Intronic
903313185 1:22476744-22476766 GAAAGATGAATGTTCCTCAAAGG - Intronic
904066980 1:27760451-27760473 GCAAGAAGGATGTTTCAAACAGG - Intronic
904363415 1:29993391-29993413 GAAAGAAGGGTGTCACTCAAAGG + Intergenic
907612349 1:55884899-55884921 TTGAGAAGGATGTTTCTAACTGG + Intergenic
907675843 1:56517228-56517250 GAAGGGAGAAAGTTTCTCACTGG - Intronic
908068098 1:60429520-60429542 GAAAGAAGGAGGTATCTATCAGG + Intergenic
908953433 1:69590657-69590679 GAAAGTAGTAGGTTTCTAACTGG + Intronic
909815611 1:79989063-79989085 GAAAGAAGGAAATCTCTGACAGG - Intergenic
910995736 1:93102613-93102635 TAAAAAAGCATGTTTCTCATAGG - Intronic
912653588 1:111464369-111464391 GAAAGAATGAAGTTTTTCAGTGG + Intergenic
913560391 1:120013145-120013167 GGAAGCATGATGTTTCTCACTGG - Intronic
913637735 1:120780433-120780455 GGAAGCATGATGTTTCTCACTGG + Intergenic
914280977 1:146172553-146172575 GGAAGCATGATGTTTCTCACTGG - Intronic
914542019 1:148623492-148623514 GGAAGCATGATGTTTCTCACTGG - Intronic
914624621 1:149447752-149447774 GGAAGCATGATGTTTCTCACTGG + Intergenic
916607480 1:166357657-166357679 GAAAGAACAATGTTTCTCAATGG - Intergenic
917743162 1:177981424-177981446 GAAAGAAGGATGTTTCTCACTGG + Intronic
920287279 1:204889678-204889700 GAAACAAGGATATTGCACACTGG - Intronic
921346870 1:214195376-214195398 GAGAGAATGATGTTTCACAAGGG + Intergenic
921893601 1:220376983-220377005 CAATGAAGGATTTTACTCACAGG - Intergenic
923551618 1:234968747-234968769 GATAGTAGGATGTCCCTCACAGG - Intergenic
924540251 1:244974057-244974079 GAAAGAAGAATGTTTGAAACGGG + Intronic
1064509139 10:16070526-16070548 GAAAAAAGGAAGATTATCACAGG - Intergenic
1064657446 10:17570021-17570043 GGAGGAAGGATTATTCTCACTGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065692862 10:28353461-28353483 GAAAGAAAGATGTTTCCCAGAGG - Intergenic
1065824854 10:29561426-29561448 GAAAGAGGGATGCTTCTGACTGG + Intronic
1066024294 10:31338335-31338357 GATAGCAGGATCTTTCTCATAGG - Intronic
1066567895 10:36739676-36739698 GAAAGAAGGATTGTTATCATAGG - Intergenic
1067126451 10:43520220-43520242 GAAAGAGGGATCTTTCTCTCTGG - Intergenic
1067412338 10:46076156-46076178 GACAGGAGGATGTTGCCCACAGG - Intergenic
1067969839 10:50957475-50957497 GAAAGAAGAATGTTTTTCTGAGG - Intergenic
1069139147 10:64802278-64802300 GAAGGAAGAATGTTTCTACCAGG - Intergenic
1069913131 10:71771922-71771944 GAAAGCAGGAAGGGTCTCACAGG + Intronic
1070900740 10:80026906-80026928 GAAAGAAAGATGTTTCCCAATGG + Intergenic
1070901447 10:80033423-80033445 GAAAGAAAGATGTTTCCCAATGG + Intergenic
1070902480 10:80042671-80042693 GAAAGAAAGATGTTTCCCAATGG + Intergenic
1071489519 10:86126836-86126858 CAGAGAAGGATGTTTCCCCCAGG + Intronic
1071935918 10:90530468-90530490 CAAAGAAAGATGTTTCTGAGAGG + Intergenic
1073732621 10:106308194-106308216 GAGAGAAGGATACTTCCCACTGG - Intergenic
1074005756 10:109421443-109421465 GAGAGAAAGAAGTTTCTCAGTGG + Intergenic
1074274354 10:111987336-111987358 GAAAGAAGGATGTATCTTAACGG + Intergenic
1075011696 10:118875909-118875931 GAACCAGGGATATTTCTCACGGG + Intergenic
1075230078 10:120668840-120668862 GAGAGAAGGATGTTCCTTGCAGG + Intergenic
1075408799 10:122212243-122212265 CAAAGAAGGGTGTTTCTTACGGG - Intronic
1076274320 10:129183738-129183760 TAGAAAAGGATGTTTCTCATTGG + Intergenic
1080041704 11:27766094-27766116 TAAAAAGGGATGCTTCTCACTGG + Intergenic
1081305906 11:41511964-41511986 GATAGAAGGATGGTTCTTCCAGG + Intergenic
1082731341 11:56801863-56801885 GAAAGAAAGAAGTTTCTTATAGG - Intergenic
1085585338 11:77698296-77698318 GAAAGTAGGATCTTGATCACTGG + Intronic
1085894647 11:80624035-80624057 GGAAGTAGTATGTTTCCCACTGG + Intergenic
1086644362 11:89201358-89201380 GAAATAATCATGTTTCCCACAGG - Intronic
1086986869 11:93260794-93260816 TATAGAAGGGTGTGTCTCACGGG - Intergenic
1087934943 11:104022081-104022103 GAAAGAAGAATGTTTCAAACTGG + Intronic
1088124020 11:106402199-106402221 GAAAGACTGCTGTTTTTCACAGG + Intergenic
1088940352 11:114447858-114447880 CAAAGAAGGCTGCTTCTCATAGG + Exonic
1090500600 11:127257236-127257258 GAAAAAAGAATGGTTCTCAAAGG - Intergenic
1091332761 11:134743564-134743586 GAAGGGAGGATGATTCGCACAGG - Intergenic
1095208459 12:39465560-39465582 AAAAGAAATATGTTTCACACAGG + Intergenic
1098885085 12:75952853-75952875 AAAAGAAGCATTTTTCTCTCAGG - Intergenic
1099237926 12:80104250-80104272 GAGATTGGGATGTTTCTCACTGG - Intergenic
1099471273 12:83051913-83051935 TAAAGGAGGATGTTTTTAACTGG + Intronic
1100046743 12:90391652-90391674 GAAAGAAGAATGTTTTTAAAAGG - Intergenic
1102731625 12:115116268-115116290 GAAAGAAGAATCATTCTCAGAGG - Intergenic
1104091198 12:125519196-125519218 GAAAGCAGGCTGTCTTTCACTGG - Intronic
1105615911 13:22012013-22012035 CAAGGAAGGATGTTTGCCACAGG - Intergenic
1107254202 13:38403932-38403954 AAAAGAAAGATGTTCCTCAGTGG + Intergenic
1107742053 13:43460938-43460960 GAAAGAAGAGTGTTTCTAATAGG - Intronic
1108556509 13:51598505-51598527 GCAACAAGGATCTTTCACACAGG + Intronic
1112628480 13:101134371-101134393 GATAAAAAGATGTTTCACACAGG - Intronic
1113010646 13:105761898-105761920 GACAGAAAGATCTCTCTCACGGG - Intergenic
1113403502 13:110017555-110017577 GAAGTGAGGATGTTTCTCCCAGG + Intergenic
1114583567 14:23788435-23788457 GAAAGAAGGAGGTTTGTTTCAGG - Intergenic
1119213538 14:72850601-72850623 GAAAGAATGAGGTGTCTCTCTGG - Intronic
1119468124 14:74875875-74875897 GAAAGGATGATGTTACTCACAGG + Intergenic
1120684556 14:87523226-87523248 GAAAGAAAGAAGTTAGTCACTGG - Intergenic
1124468650 15:29963237-29963259 GATAGAAGGTTGTTTCTCCAAGG - Intronic
1125290995 15:38146633-38146655 GAGAGATGGATGATCCTCACTGG - Intergenic
1127484849 15:59409372-59409394 GGAAGAGGGATTTTTCTCAGAGG - Intronic
1129775458 15:78233605-78233627 GAGAGAAGGAGGTTTCTAACTGG - Intronic
1129786519 15:78313661-78313683 GGAAGAAGGGTCTTTCTCACAGG + Intergenic
1133665166 16:7960053-7960075 AAAAGAAAGATATTTCTCAAGGG + Intergenic
1134260099 16:12644181-12644203 GAAAGAGGGACGTTGTTCACGGG + Intergenic
1134420826 16:14087340-14087362 GAAGGAAGGAAATTTCTCAAGGG - Intronic
1135561172 16:23478244-23478266 GAAAGAAAGATGTTTCTCCAGGG + Intronic
1137475291 16:48802740-48802762 GAAATAAGGATGTTTTCCATGGG + Intergenic
1139377107 16:66506595-66506617 CAAAAAAAAATGTTTCTCACAGG - Intronic
1143539438 17:7560510-7560532 GAAAGCAGGACGTCTCTGACCGG + Intronic
1147417288 17:40301879-40301901 GAGAAAAGGATTTTTCACACTGG - Intronic
1147865863 17:43551792-43551814 AAAATTAAGATGTTTCTCACTGG - Intronic
1149747333 17:59111385-59111407 GATAGAAAGATGTTAATCACAGG - Exonic
1150419526 17:65019642-65019664 GAAAGAAGGATGGTTACCAAAGG + Intronic
1154109440 18:11553056-11553078 CCAAGAAGAATGTTTCTGACAGG + Intergenic
1154209488 18:12367294-12367316 GCAAGAAAGATGATTCTCACTGG - Exonic
1158196778 18:54896108-54896130 GCAATAATGCTGTTTCTCACAGG + Intergenic
1159084106 18:63768430-63768452 GTAATAAAGGTGTTTCTCACAGG - Intronic
1159194358 18:65093140-65093162 GAAAGAAACATTTTTCTCAATGG - Intergenic
1159399486 18:67912205-67912227 GAAAGAAGAATCTTTCTCTGCGG + Intergenic
1159552052 18:69905408-69905430 GCAAGGAAGATGTTTCCCACAGG + Intronic
1159647638 18:70937895-70937917 GAAAGTACCATGTTTCTCAGGGG - Intergenic
1161615096 19:5265691-5265713 GGTAGAATGATATTTCTCACTGG + Intronic
1162397954 19:10428805-10428827 GAAGGAAGGATATTTCACAGAGG + Intronic
1162784801 19:13027922-13027944 GAAGGTAGGATTTTTCTCACTGG + Intronic
1164615033 19:29662701-29662723 GAAAGAATGAGGTTTCTCCGAGG - Intergenic
1168493553 19:56831561-56831583 GAACAAAGTATGTTTGTCACTGG - Intronic
926276485 2:11407128-11407150 GAAAGAAGAATCTCCCTCACTGG - Intergenic
926498223 2:13618065-13618087 AACAAAATGATGTTTCTCACTGG + Intergenic
927168960 2:20352107-20352129 GAGACAAGGATGGTTCTCAGAGG - Intronic
928237460 2:29556673-29556695 GAAACCTGGATGGTTCTCACAGG - Intronic
928471250 2:31579039-31579061 GAAAGAAGGATGTTGGATACAGG - Intronic
928794530 2:35000638-35000660 GAATGAAGGATGTCTCTTACAGG + Intergenic
929504327 2:42516581-42516603 GAAAGAAGGAAATGGCTCACCGG + Intronic
929873887 2:45780545-45780567 GAAAGAAGGACACATCTCACTGG + Intronic
931995719 2:67837470-67837492 GAAAGAGGGATGTTTCACGTCGG + Intergenic
932738009 2:74269138-74269160 GAAAGTAAGATGTTTCTAAAAGG + Intronic
936678893 2:114748278-114748300 TCAAGATGCATGTTTCTCACGGG - Intronic
938696513 2:133840201-133840223 GAAGGCAGGATGATTCCCACTGG - Intergenic
938699634 2:133864371-133864393 GCAAGAAGGATTTTTCTAACTGG - Intergenic
940857077 2:158737835-158737857 GAATGAAGGATGGTTTTCAAGGG - Intergenic
941000853 2:160202455-160202477 GAAAGAAAGAGGTTTCTGTCTGG + Intronic
942773240 2:179548308-179548330 TAAAGAAGGATGCTTGTTACTGG - Intronic
946734301 2:222739172-222739194 GCAAGAAGGAAGTTTGTTACGGG + Intergenic
947728190 2:232413612-232413634 GAAAGAATTAAGTTTCTCCCTGG + Intergenic
1168876390 20:1174947-1174969 GAAAGAAGGGTGTGTCTAACGGG - Intronic
1168877169 20:1179947-1179969 GCAAGAAGGATCTTTTACACAGG - Intronic
1169033255 20:2429824-2429846 CTAGGAAGGATGTTTCTGACTGG + Intronic
1169811605 20:9614198-9614220 AAATGAAGGATGCTTCTCACGGG + Intronic
1170089238 20:12572136-12572158 CAAAGAAGGATGATTCTTAGGGG + Intergenic
1172704373 20:36872320-36872342 GAGATGAGGACGTTTCTCACTGG - Intergenic
1173320976 20:41986607-41986629 TAAAGTAGGATGTGTCTCAATGG + Intergenic
1175392558 20:58636268-58636290 GAAGGAAGCAGGGTTCTCACTGG + Intergenic
1175400380 20:58696824-58696846 GACAACAGGATGTATCTCACAGG - Intronic
1178081672 21:29073026-29073048 GAAAGCCGTATGTTTCTCACTGG + Intronic
1181423968 22:22820861-22820883 GAAAGAATGATTTTTTACACAGG - Intronic
949962398 3:9323384-9323406 GAAATAAGAATCTTTATCACAGG + Intronic
950336017 3:12193786-12193808 GCAAGAAGGCTGTTTCTGAATGG - Intergenic
952108449 3:30095416-30095438 GAAAGAAACATTTTTCTAACTGG + Intergenic
953187704 3:40653872-40653894 GAACTAAAGATGTTTCTCAAGGG + Intergenic
953712430 3:45285807-45285829 GGAAGAAGGCAGTTTCTCTCAGG + Intergenic
956351467 3:68341569-68341591 GAAAGAAGGGTGTTTTTTTCTGG + Intronic
956994640 3:74810550-74810572 GAAGAAAGGATGTTTCTTAAAGG + Intergenic
958113990 3:89190536-89190558 AAAAGAAGTATTTTTCTCACAGG + Intronic
958114080 3:89191531-89191553 AAAAGAAGTATTTTTCTCACAGG - Intronic
959119692 3:102218288-102218310 GAAAGAACAATGTTTCCCAATGG + Intronic
960804540 3:121570814-121570836 CAAAGAAGGATGATACTCACTGG - Exonic
961077725 3:123997429-123997451 GAAAGGAGAATATTTGTCACTGG + Intergenic
962435596 3:135363678-135363700 GCAAGATGGAAGTTTGTCACAGG + Intergenic
962897972 3:139733093-139733115 GAAAGAAGGATGTGTCACTCTGG + Intergenic
963009171 3:140753215-140753237 CAAAGAAGCATTTTTCTAACAGG + Intergenic
965472318 3:169109926-169109948 GAAAGAAGGATGCTTCATAGTGG - Intronic
965951370 3:174312058-174312080 AAAAGAAGGATGTTTTCTACTGG - Intergenic
966653301 3:182325354-182325376 CAAGTAAGGATGTCTCTCACAGG - Intergenic
974630825 4:64485917-64485939 GTTAGAAGCATGTTGCTCACAGG + Intergenic
975196431 4:71530053-71530075 AAAAAAAGGATGTTTCTTAGGGG - Intronic
978880694 4:113699042-113699064 GAAGAAATGATGTTTCTCAGTGG + Intronic
979997301 4:127446054-127446076 TAAAGAAGGATGTGTGTGACGGG - Intergenic
981699001 4:147587534-147587556 GAAGGAAGGAAGTTCCTAACTGG - Intergenic
982146874 4:152404197-152404219 GATAAAAAGATGTTCCTCACAGG - Intronic
983543479 4:168937029-168937051 CAAAGGAGGATCTTTCTCTCTGG - Intronic
983761279 4:171409333-171409355 GAAAGGAAGATGTTACTCAATGG + Intergenic
984018350 4:174453422-174453444 GAAAGAAGCATTTTTTTCATAGG - Intergenic
984598119 4:181694806-181694828 GAAAAAAACATGTTTATCACTGG + Intergenic
985167061 4:187107742-187107764 GAATGAAGTATGTTTCTGATGGG + Intergenic
987060621 5:14239883-14239905 TAACGAAGGATGCTTTTCACGGG + Intronic
987735923 5:21843243-21843265 GAAAGTAGCATGTTTCTTAAAGG - Intronic
988642851 5:33060543-33060565 GAAAGTAGGATTTGGCTCACTGG + Intergenic
988792117 5:34618396-34618418 GAAAGAAGTATGTTTTTTAATGG - Intergenic
992100857 5:73406138-73406160 CTAAGTAGGATGTTTCTCATGGG + Intergenic
992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG + Intergenic
995305888 5:110649244-110649266 GAAAGAAGGATTTTTTTAATTGG + Intronic
995981112 5:118105295-118105317 AAAATAAGGGTGTTCCTCACAGG - Intergenic
997446425 5:133943541-133943563 GAAAGATGGAACTTTTTCACGGG + Intergenic
998343427 5:141439484-141439506 GAGAGAAAGACGTTTCTCACTGG - Intronic
998540861 5:142980195-142980217 GAAACATGGATGAGTCTCACAGG - Intronic
1000107328 5:158072714-158072736 GAAAACAGTATTTTTCTCACAGG - Intergenic
1003156879 6:3604209-3604231 TGAAGCAGCATGTTTCTCACGGG - Intergenic
1005513470 6:26532794-26532816 TAAACAAGGAGGTTTCACACCGG + Intergenic
1007436778 6:41818725-41818747 GGAAGAAAGATGTCACTCACAGG + Intronic
1008354053 6:50530498-50530520 GAGAGAATGAGGTTTCTCTCAGG - Intergenic
1008797806 6:55325943-55325965 GAGAGAAGGATGTTTGCCAAGGG + Intergenic
1011884405 6:92076196-92076218 GAAAATAGGAAGCTTCTCACAGG - Intergenic
1012038710 6:94175777-94175799 GAAAGATGGATGTTTATCAGTGG - Intergenic
1012237988 6:96839485-96839507 GAAAGAAAGAGGTTTCCCAAAGG + Intergenic
1012371914 6:98517591-98517613 TAAAGGAGGATATTTCTCCCAGG + Intergenic
1013350574 6:109302101-109302123 GGAGGAAGGATGTTGCTCAGGGG + Intergenic
1013821633 6:114160498-114160520 GACAGAAGTATGATTCTCCCTGG + Intronic
1013853852 6:114547993-114548015 CAAAGAAGAATGTTTGTCAGTGG + Intergenic
1015629807 6:135220733-135220755 GAAAGAAGGAAGTTTATCCCTGG - Intergenic
1015871347 6:137779589-137779611 GAAAGGAGAATCTTTCTCAGAGG - Intergenic
1016227529 6:141758203-141758225 TAAAGATGGATGGTTCTCTCAGG + Intergenic
1016391986 6:143584142-143584164 GTAAAAAGAATGTATCTCACAGG - Intronic
1017926489 6:158915450-158915472 GAAGGAAGGAGGCTGCTCACTGG + Intergenic
1020433173 7:8133828-8133850 AAAAGTATGATTTTTCTCACTGG - Intronic
1022202779 7:28133793-28133815 GGAAGAAGACTGTTTCTCAGAGG - Intronic
1025271373 7:57522057-57522079 AAAAGCAGGATGTTTCTAAAGGG - Intergenic
1026344280 7:69460938-69460960 GAAAGATGCATATATCTCACAGG + Intergenic
1026508014 7:71003162-71003184 GAAATAAGGAAGTCTCTCAGTGG - Intergenic
1029195641 7:98803519-98803541 GCAAGAAGGATGGGTCTCCCTGG - Intergenic
1031685047 7:124723086-124723108 GAAAGAAAGATATTTGCCACAGG + Intergenic
1031867723 7:127057107-127057129 TAAAGCTGTATGTTTCTCACTGG - Intronic
1034954578 7:155326738-155326760 CAAAGAAGGAGGTTTCTCTTGGG - Intergenic
1037267633 8:17083432-17083454 GCAAGAAGGAGGTTTGTTACGGG + Intronic
1037860836 8:22404540-22404562 AAAAGAAGGGTTTTTCTCAAAGG + Intronic
1037928491 8:22863838-22863860 AAAAGAAGGATGTGTCACTCTGG + Intronic
1038936747 8:32260245-32260267 GAAAGAAGGAAGTCTCTCTGAGG + Intronic
1040079320 8:43271575-43271597 GCAAGAAAGATGATTCTCACTGG - Intergenic
1041679076 8:60568345-60568367 GACAGATGGCTCTTTCTCACAGG + Intronic
1042746337 8:72111383-72111405 GAAAGTAGAATGATTCACACCGG - Intronic
1045319723 8:101072937-101072959 GAAACAATTATGTATCTCACTGG - Intergenic
1045778120 8:105830768-105830790 GAAAGAAAGCTGTTTCCCAATGG + Intergenic
1046167287 8:110453036-110453058 AGAAGAATAATGTTTCTCACAGG + Intergenic
1046599805 8:116302884-116302906 AAAGGGAGGATGTTTATCACTGG + Intergenic
1046836801 8:118810894-118810916 GCAAGCAAGATGTATCTCACTGG + Intergenic
1049121922 8:140747357-140747379 GAAAGAAGGATTTTTCTTAGAGG - Intronic
1049350995 8:142164660-142164682 AAGAGAAGGCAGTTTCTCACAGG + Intergenic
1051395015 9:16610356-16610378 TAAGGAAAGATGTTACTCACTGG - Intronic
1051617776 9:19022784-19022806 GAAAGAAAAATGTTTCTAAATGG - Intronic
1052276780 9:26685624-26685646 GAAAGAAGGCAACTTCTCACTGG + Intergenic
1053336644 9:37279856-37279878 TAAACAAGGATGTTTCCCACCGG + Intronic
1055262373 9:74452379-74452401 GAAAGAATGATGGTTATCCCTGG + Intergenic
1055670821 9:78604633-78604655 GAAAGAGAGAAGTTTCTCACAGG + Intergenic
1055903131 9:81263867-81263889 AATAGAAGGATGTTTATCAGAGG + Intergenic
1057400089 9:94715616-94715638 AAAAGAAAAATGTTTCCCACGGG - Intergenic
1058390237 9:104488063-104488085 GGAAGAAGTTTGTTTCTAACAGG + Intergenic
1058608215 9:106746221-106746243 GAAAGAAGGCTTCTTTTCACTGG + Intergenic
1185878595 X:3720288-3720310 GAAGGAAGGATTTTTCTTTCTGG - Intergenic
1186127353 X:6428205-6428227 ACAAGCAGGATGTTTTTCACTGG + Intergenic
1187517568 X:19986563-19986585 AAAAGAAGGATGTTTCAAAAAGG + Intergenic
1187806975 X:23131299-23131321 GAAAGAAGCATGTGACTCAATGG + Intergenic
1188376344 X:29433403-29433425 GAAGGAAGAATGTATGTCACAGG - Intronic
1188818057 X:34739604-34739626 GGAAGAAGGATATTTCACTCAGG + Intergenic
1189247864 X:39577379-39577401 GAATGAAGTATGTGACTCACAGG - Intergenic
1194517521 X:94874552-94874574 GAAAAAAATATGTTTCTTACTGG - Intergenic
1196118785 X:112025912-112025934 GAAAGAAGTTTATTACTCACAGG - Intronic
1196612113 X:117727153-117727175 GAAAAAAGGATGTTTCGGCCGGG - Intergenic
1197857006 X:130924543-130924565 GAAAGAAGGATATTTCATAATGG - Intergenic
1199407530 X:147479912-147479934 GAAAGATGGATGTTTCTGGTTGG - Intergenic
1201719802 Y:17084042-17084064 GAAAGAAGTATGTCCCTCACAGG - Intergenic