ID: 917750304

View in Genome Browser
Species Human (GRCh38)
Location 1:178047270-178047292
Sequence CAAGGGACTGACAATCTATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750304_917750309 24 Left 917750304 1:178047270-178047292 CCCGATAGATTGTCAGTCCCTTG No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750304 Original CRISPR CAAGGGACTGACAATCTATC GGG (reversed) Intergenic
No off target data available for this crispr