ID: 917750305

View in Genome Browser
Species Human (GRCh38)
Location 1:178047271-178047293
Sequence TCAAGGGACTGACAATCTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750305_917750309 23 Left 917750305 1:178047271-178047293 CCGATAGATTGTCAGTCCCTTGA No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data
917750305_917750311 30 Left 917750305 1:178047271-178047293 CCGATAGATTGTCAGTCCCTTGA No data
Right 917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750305 Original CRISPR TCAAGGGACTGACAATCTAT CGG (reversed) Intergenic
No off target data available for this crispr