ID: 917750306

View in Genome Browser
Species Human (GRCh38)
Location 1:178047287-178047309
Sequence GAGACAGTCTCTATTCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750306_917750309 7 Left 917750306 1:178047287-178047309 CCCTTGAGAATAGAGACTGTCTC No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data
917750306_917750313 18 Left 917750306 1:178047287-178047309 CCCTTGAGAATAGAGACTGTCTC No data
Right 917750313 1:178047328-178047350 CACCACTCCTGGAACATGGCAGG No data
917750306_917750311 14 Left 917750306 1:178047287-178047309 CCCTTGAGAATAGAGACTGTCTC No data
Right 917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750306 Original CRISPR GAGACAGTCTCTATTCTCAA GGG (reversed) Intergenic
No off target data available for this crispr