ID: 917750307

View in Genome Browser
Species Human (GRCh38)
Location 1:178047288-178047310
Sequence TGAGACAGTCTCTATTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750307_917750313 17 Left 917750307 1:178047288-178047310 CCTTGAGAATAGAGACTGTCTCA No data
Right 917750313 1:178047328-178047350 CACCACTCCTGGAACATGGCAGG No data
917750307_917750311 13 Left 917750307 1:178047288-178047310 CCTTGAGAATAGAGACTGTCTCA No data
Right 917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG No data
917750307_917750309 6 Left 917750307 1:178047288-178047310 CCTTGAGAATAGAGACTGTCTCA No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750307 Original CRISPR TGAGACAGTCTCTATTCTCA AGG (reversed) Intergenic
No off target data available for this crispr