ID: 917750308

View in Genome Browser
Species Human (GRCh38)
Location 1:178047315-178047337
Sequence AGGAGTGGTGGTAGGCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750308_917750313 -10 Left 917750308 1:178047315-178047337 CCTCAGAGCCTACCACCACTCCT No data
Right 917750313 1:178047328-178047350 CACCACTCCTGGAACATGGCAGG No data
917750308_917750317 8 Left 917750308 1:178047315-178047337 CCTCAGAGCCTACCACCACTCCT No data
Right 917750317 1:178047346-178047368 GCAGGTACTCAGTAAATGGTAGG No data
917750308_917750316 4 Left 917750308 1:178047315-178047337 CCTCAGAGCCTACCACCACTCCT No data
Right 917750316 1:178047342-178047364 CATGGCAGGTACTCAGTAAATGG No data
917750308_917750319 19 Left 917750308 1:178047315-178047337 CCTCAGAGCCTACCACCACTCCT No data
Right 917750319 1:178047357-178047379 GTAAATGGTAGGAAGGTGTGAGG No data
917750308_917750318 12 Left 917750308 1:178047315-178047337 CCTCAGAGCCTACCACCACTCCT No data
Right 917750318 1:178047350-178047372 GTACTCAGTAAATGGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750308 Original CRISPR AGGAGTGGTGGTAGGCTCTG AGG (reversed) Intergenic
No off target data available for this crispr