ID: 917750309

View in Genome Browser
Species Human (GRCh38)
Location 1:178047317-178047339
Sequence TCAGAGCCTACCACCACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750306_917750309 7 Left 917750306 1:178047287-178047309 CCCTTGAGAATAGAGACTGTCTC No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data
917750305_917750309 23 Left 917750305 1:178047271-178047293 CCGATAGATTGTCAGTCCCTTGA No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data
917750304_917750309 24 Left 917750304 1:178047270-178047292 CCCGATAGATTGTCAGTCCCTTG No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data
917750307_917750309 6 Left 917750307 1:178047288-178047310 CCTTGAGAATAGAGACTGTCTCA No data
Right 917750309 1:178047317-178047339 TCAGAGCCTACCACCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750309 Original CRISPR TCAGAGCCTACCACCACTCC TGG Intergenic
No off target data available for this crispr