ID: 917750311

View in Genome Browser
Species Human (GRCh38)
Location 1:178047324-178047346
Sequence CTACCACCACTCCTGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750306_917750311 14 Left 917750306 1:178047287-178047309 CCCTTGAGAATAGAGACTGTCTC No data
Right 917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG No data
917750307_917750311 13 Left 917750307 1:178047288-178047310 CCTTGAGAATAGAGACTGTCTCA No data
Right 917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG No data
917750305_917750311 30 Left 917750305 1:178047271-178047293 CCGATAGATTGTCAGTCCCTTGA No data
Right 917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750311 Original CRISPR CTACCACCACTCCTGGAACA TGG Intergenic
No off target data available for this crispr