ID: 917750313

View in Genome Browser
Species Human (GRCh38)
Location 1:178047328-178047350
Sequence CACCACTCCTGGAACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917750308_917750313 -10 Left 917750308 1:178047315-178047337 CCTCAGAGCCTACCACCACTCCT No data
Right 917750313 1:178047328-178047350 CACCACTCCTGGAACATGGCAGG No data
917750306_917750313 18 Left 917750306 1:178047287-178047309 CCCTTGAGAATAGAGACTGTCTC No data
Right 917750313 1:178047328-178047350 CACCACTCCTGGAACATGGCAGG No data
917750307_917750313 17 Left 917750307 1:178047288-178047310 CCTTGAGAATAGAGACTGTCTCA No data
Right 917750313 1:178047328-178047350 CACCACTCCTGGAACATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917750313 Original CRISPR CACCACTCCTGGAACATGGC AGG Intergenic
No off target data available for this crispr