ID: 917755412

View in Genome Browser
Species Human (GRCh38)
Location 1:178093832-178093854
Sequence CGCGGCGGATCCCACAAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917755412_917755417 -2 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755417 1:178093853-178093875 CGGAGCAGGAGCCAGAGCTGTGG 0: 1
1: 1
2: 10
3: 78
4: 660
917755412_917755427 30 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755427 1:178093885-178093907 TGGCCTGAGAGTCAGGGGGCGGG 0: 1
1: 1
2: 2
3: 55
4: 416
917755412_917755423 24 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378
917755412_917755425 26 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755425 1:178093881-178093903 GCTGTGGCCTGAGAGTCAGGGGG 0: 1
1: 0
2: 5
3: 43
4: 423
917755412_917755418 2 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755418 1:178093857-178093879 GCAGGAGCCAGAGCTGTGGCCGG 0: 1
1: 0
2: 9
3: 87
4: 791
917755412_917755424 25 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755424 1:178093880-178093902 AGCTGTGGCCTGAGAGTCAGGGG 0: 1
1: 0
2: 2
3: 41
4: 378
917755412_917755426 29 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755426 1:178093884-178093906 GTGGCCTGAGAGTCAGGGGGCGG 0: 1
1: 0
2: 4
3: 45
4: 466
917755412_917755420 10 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755412_917755422 23 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755422 1:178093878-178093900 GGAGCTGTGGCCTGAGAGTCAGG 0: 1
1: 0
2: 5
3: 45
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917755412 Original CRISPR CGCGGCGGATCCCACAAACC CGG (reversed) Intergenic