ID: 917755415

View in Genome Browser
Species Human (GRCh38)
Location 1:178093847-178093869
Sequence CTCTGGCTCCTGCTCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 267}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917755415_917755426 14 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755426 1:178093884-178093906 GTGGCCTGAGAGTCAGGGGGCGG 0: 1
1: 0
2: 4
3: 45
4: 466
917755415_917755423 9 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378
917755415_917755424 10 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755424 1:178093880-178093902 AGCTGTGGCCTGAGAGTCAGGGG 0: 1
1: 0
2: 2
3: 41
4: 378
917755415_917755429 19 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755429 1:178093889-178093911 CTGAGAGTCAGGGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 361
917755415_917755425 11 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755425 1:178093881-178093903 GCTGTGGCCTGAGAGTCAGGGGG 0: 1
1: 0
2: 5
3: 43
4: 423
917755415_917755420 -5 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755415_917755422 8 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755422 1:178093878-178093900 GGAGCTGTGGCCTGAGAGTCAGG 0: 1
1: 0
2: 5
3: 45
4: 467
917755415_917755427 15 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755427 1:178093885-178093907 TGGCCTGAGAGTCAGGGGGCGGG 0: 1
1: 1
2: 2
3: 55
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917755415 Original CRISPR CTCTGGCTCCTGCTCCGCGG CGG (reversed) Intergenic