ID: 917755416

View in Genome Browser
Species Human (GRCh38)
Location 1:178093850-178093872
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 1, 2: 5, 3: 63, 4: 462}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917755416_917755420 -8 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755416_917755424 7 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755424 1:178093880-178093902 AGCTGTGGCCTGAGAGTCAGGGG 0: 1
1: 0
2: 2
3: 41
4: 378
917755416_917755429 16 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755429 1:178093889-178093911 CTGAGAGTCAGGGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 361
917755416_917755425 8 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755425 1:178093881-178093903 GCTGTGGCCTGAGAGTCAGGGGG 0: 1
1: 0
2: 5
3: 43
4: 423
917755416_917755423 6 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378
917755416_917755422 5 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755422 1:178093878-178093900 GGAGCTGTGGCCTGAGAGTCAGG 0: 1
1: 0
2: 5
3: 45
4: 467
917755416_917755427 12 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755427 1:178093885-178093907 TGGCCTGAGAGTCAGGGGGCGGG 0: 1
1: 1
2: 2
3: 55
4: 416
917755416_917755426 11 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755426 1:178093884-178093906 GTGGCCTGAGAGTCAGGGGGCGG 0: 1
1: 0
2: 4
3: 45
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917755416 Original CRISPR CAGCTCTGGCTCCTGCTCCG CGG (reversed) Intergenic