ID: 917755419

View in Genome Browser
Species Human (GRCh38)
Location 1:178093864-178093886
Sequence CACAGCTCCGGCCACAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 301}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917755419_917755423 -8 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378
917755419_917755422 -9 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755422 1:178093878-178093900 GGAGCTGTGGCCTGAGAGTCAGG 0: 1
1: 0
2: 5
3: 45
4: 467
917755419_917755430 18 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755430 1:178093905-178093927 GGGCAGGCTCATTCCAGAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 191
917755419_917755431 19 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755431 1:178093906-178093928 GGCAGGCTCATTCCAGAAGTGGG 0: 1
1: 0
2: 3
3: 9
4: 173
917755419_917755424 -7 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755424 1:178093880-178093902 AGCTGTGGCCTGAGAGTCAGGGG 0: 1
1: 0
2: 2
3: 41
4: 378
917755419_917755429 2 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755429 1:178093889-178093911 CTGAGAGTCAGGGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 361
917755419_917755426 -3 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755426 1:178093884-178093906 GTGGCCTGAGAGTCAGGGGGCGG 0: 1
1: 0
2: 4
3: 45
4: 466
917755419_917755425 -6 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755425 1:178093881-178093903 GCTGTGGCCTGAGAGTCAGGGGG 0: 1
1: 0
2: 5
3: 43
4: 423
917755419_917755434 27 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755434 1:178093914-178093936 CATTCCAGAAGTGGGGGCCGAGG 0: 1
1: 0
2: 0
3: 16
4: 178
917755419_917755427 -2 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755427 1:178093885-178093907 TGGCCTGAGAGTCAGGGGGCGGG 0: 1
1: 1
2: 2
3: 55
4: 416
917755419_917755432 20 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755432 1:178093907-178093929 GCAGGCTCATTCCAGAAGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 233
917755419_917755433 21 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755433 1:178093908-178093930 CAGGCTCATTCCAGAAGTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917755419 Original CRISPR CACAGCTCCGGCCACAGCTC TGG (reversed) Intergenic