ID: 917755420

View in Genome Browser
Species Human (GRCh38)
Location 1:178093865-178093887
Sequence CAGAGCTGTGGCCGGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 1, 2: 4, 3: 50, 4: 529}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917755411_917755420 19 Left 917755411 1:178093823-178093845 CCGTGGCTGCCGGGTTTGTGGGA 0: 1
1: 0
2: 0
3: 18
4: 153
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755412_917755420 10 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755405_917755420 28 Left 917755405 1:178093814-178093836 CCGCCACCGCCGTGGCTGCCGGG 0: 1
1: 0
2: 3
3: 32
4: 309
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755415_917755420 -5 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755416_917755420 -8 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755407_917755420 25 Left 917755407 1:178093817-178093839 CCACCGCCGTGGCTGCCGGGTTT 0: 1
1: 0
2: 0
3: 9
4: 90
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529
917755408_917755420 22 Left 917755408 1:178093820-178093842 CCGCCGTGGCTGCCGGGTTTGTG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 917755420 1:178093865-178093887 CAGAGCTGTGGCCGGAGCTGTGG 0: 1
1: 1
2: 4
3: 50
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917755420 Original CRISPR CAGAGCTGTGGCCGGAGCTG TGG Intergenic