ID: 917755423

View in Genome Browser
Species Human (GRCh38)
Location 1:178093879-178093901
Sequence GAGCTGTGGCCTGAGAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 378}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917755416_917755423 6 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378
917755412_917755423 24 Left 917755412 1:178093832-178093854 CCGGGTTTGTGGGATCCGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 46
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378
917755419_917755423 -8 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378
917755415_917755423 9 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917755423 Original CRISPR GAGCTGTGGCCTGAGAGTCA GGG Intergenic