ID: 917755429

View in Genome Browser
Species Human (GRCh38)
Location 1:178093889-178093911
Sequence CTGAGAGTCAGGGGGCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917755419_917755429 2 Left 917755419 1:178093864-178093886 CCAGAGCTGTGGCCGGAGCTGTG 0: 1
1: 0
2: 4
3: 41
4: 301
Right 917755429 1:178093889-178093911 CTGAGAGTCAGGGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 361
917755416_917755429 16 Left 917755416 1:178093850-178093872 CCGCGGAGCAGGAGCCAGAGCTG 0: 1
1: 1
2: 5
3: 63
4: 462
Right 917755429 1:178093889-178093911 CTGAGAGTCAGGGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 361
917755421_917755429 -10 Left 917755421 1:178093876-178093898 CCGGAGCTGTGGCCTGAGAGTCA 0: 1
1: 0
2: 2
3: 31
4: 289
Right 917755429 1:178093889-178093911 CTGAGAGTCAGGGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 361
917755415_917755429 19 Left 917755415 1:178093847-178093869 CCGCCGCGGAGCAGGAGCCAGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 917755429 1:178093889-178093911 CTGAGAGTCAGGGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917755429 Original CRISPR CTGAGAGTCAGGGGGCGGGC AGG Intergenic