ID: 917756755

View in Genome Browser
Species Human (GRCh38)
Location 1:178109101-178109123
Sequence GACATAGCTTTATTTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917756754_917756755 -2 Left 917756754 1:178109080-178109102 CCACAAGTTGTATTCATCTGGGA 0: 1
1: 0
2: 2
3: 10
4: 177
Right 917756755 1:178109101-178109123 GACATAGCTTTATTTACTCCAGG 0: 1
1: 0
2: 0
3: 19
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917756755 Original CRISPR GACATAGCTTTATTTACTCC AGG Intronic
900162499 1:1230943-1230965 GAACTAGCTTTATTTTCTCTAGG - Intronic
904861491 1:33541323-33541345 GATATAGCATTGTTCACTCCTGG + Intronic
914308582 1:146445708-146445730 GAGAGAGCTTTATTTATTGCGGG + Intergenic
914593527 1:149127422-149127444 GAGAGAGCTTTATTTATTGCGGG - Intergenic
917647710 1:177045343-177045365 TACATGGCTTGATTAACTCCAGG + Intronic
917756755 1:178109101-178109123 GACATAGCTTTATTTACTCCAGG + Intronic
919204466 1:194403827-194403849 GACATAGATTCATATACTCCAGG + Intergenic
920614479 1:207476290-207476312 AACATAGCTCGATTTTCTCCTGG + Exonic
923108225 1:230870314-230870336 CATATATCTTTATCTACTCCTGG + Intergenic
924015592 1:239717858-239717880 GACATAGCTTGATAAACTGCTGG - Intronic
1067110105 10:43394535-43394557 GACAAAACTTTTTTCACTCCAGG + Intronic
1070127540 10:73634292-73634314 GACACATCTCTATATACTCCTGG + Intronic
1070510062 10:77152829-77152851 GACATAGGTTTTATTATTCCTGG - Intronic
1072084268 10:92063230-92063252 GCCATTGCTTTATTTACTTCAGG - Intronic
1073459016 10:103654938-103654960 CACTCAGCTTTATTCACTCCAGG - Intronic
1080629859 11:34064201-34064223 GACACAGCTTTATTCTTTCCTGG - Intronic
1080773070 11:35360657-35360679 TCCATAGCTTAATTTACTCCTGG + Intronic
1082816529 11:57513493-57513515 TACATAGCCTCATTTACTCTAGG - Intronic
1086256658 11:84885023-84885045 GACATAGCTTTAGGTGATCCTGG - Intronic
1086332760 11:85770366-85770388 AACATGGCTTCATTCACTCCTGG + Intronic
1089812785 11:121145298-121145320 TACATAGCATTATTTCCCCCAGG - Intronic
1091549076 12:1524223-1524245 ATCATAGCTTTGTTTACTCTTGG + Intergenic
1097142913 12:56917826-56917848 GTCATTGCTTTATTTCATCCTGG - Intergenic
1100094585 12:91017160-91017182 GACATTGCTTCATTTTCTTCTGG + Intergenic
1106073204 13:26434131-26434153 GAAATAGCTTAATATATTCCAGG + Intergenic
1109990904 13:70056182-70056204 GACACAAGTTTATCTACTCCTGG - Intronic
1110221028 13:73073799-73073821 GTGATAGCTATATTTACTACTGG + Intronic
1114995171 14:28340887-28340909 AACATAGCTGTAATTACCCCTGG + Intergenic
1121560558 14:94872114-94872136 GAGATAGCTTCATCTACTCTTGG + Intergenic
1122839028 14:104445687-104445709 CACATGGCTTTATTTCATCCTGG - Intergenic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1129551474 15:76454824-76454846 GCCATAGCATTATTTAGGCCTGG + Intronic
1137750566 16:50858439-50858461 CACAGAGCTTTCTTCACTCCAGG - Intergenic
1138170559 16:54845269-54845291 GACTTATCTTTATTTATTCCTGG - Intergenic
1138681574 16:58687269-58687291 AACATAGCTTTATTGAGGCCAGG + Intergenic
1139443714 16:66983238-66983260 GACATAGTTGGATTTACTGCTGG + Intergenic
1140350059 16:74253542-74253564 AAAATAGCTGTATTTAGTCCTGG + Intergenic
1149384544 17:56128697-56128719 GACATAGGTTTCTTTACTGTAGG - Intronic
1153549140 18:6242434-6242456 GACATTGCTTTACTTGCTACTGG + Intronic
1155587104 18:27379115-27379137 GAAATGGATTTATTTACTCCAGG + Intergenic
1156062258 18:33093545-33093567 GACATATATTTATTTAGTCATGG - Intronic
1157995795 18:52553941-52553963 AACCTAGCATTATTTCCTCCTGG - Intronic
1164922157 19:32096430-32096452 GACATGGCTTTATTTAATTGAGG + Intergenic
1165280877 19:34796214-34796236 GAAACAGGTTTATTTAATCCTGG + Intergenic
935334429 2:102002254-102002276 GACATAGACATATTTTCTCCTGG - Intronic
936494980 2:113010999-113011021 CACATAGCATGATATACTCCAGG + Intergenic
937781596 2:125844720-125844742 GACTTAGCTTTAATTACCCCTGG + Intergenic
938844125 2:135191007-135191029 GACAAAGTTGTATTTATTCCTGG + Intronic
942829454 2:180222464-180222486 GATATAATTTTTTTTACTCCTGG + Intergenic
942926721 2:181441892-181441914 GACCTTGCTTTATCTACTGCAGG + Intergenic
944659970 2:201913397-201913419 GGCACAGCTGTGTTTACTCCAGG - Intergenic
1174031900 20:47635521-47635543 AACATAGCTTCATTGACCCCTGG + Exonic
1175632961 20:60557507-60557529 GACATCTCCTTATTTGCTCCTGG - Intergenic
1178737953 21:35169686-35169708 AACATAGTTTTATATACACCTGG + Intronic
1184101928 22:42345261-42345283 GACACAGCTCTACTGACTCCTGG + Intergenic
949460600 3:4289032-4289054 TACATAGCATAATTTGCTCCTGG + Intronic
950174073 3:10860014-10860036 AACATAGCTTCATTTACTTGGGG + Intronic
951109882 3:18790431-18790453 GCCATAGCTTCTTTTACTCCTGG + Intergenic
954762549 3:52887073-52887095 GTCATCGCTTTTTTTTCTCCTGG - Intronic
955624779 3:60906584-60906606 GATACATCTTTTTTTACTCCAGG + Intronic
955884869 3:63587177-63587199 GACATGGCCTTATTTAGTCACGG - Intronic
956645572 3:71452505-71452527 GACATAATTTTATTTTCTCTGGG + Intronic
957569506 3:81928186-81928208 CACCTAGCTTTATTTTCTCAGGG - Intergenic
957649783 3:82985010-82985032 GAAATAGCCTTATTTACTGCAGG - Intergenic
958158295 3:89784349-89784371 TACATGGCTTTCTTTTCTCCTGG + Intergenic
959613564 3:108322034-108322056 TGCATATTTTTATTTACTCCAGG + Intronic
960504708 3:118478781-118478803 GAGTTAGCAGTATTTACTCCTGG - Intergenic
967077332 3:186015331-186015353 AACATAACTTTATACACTCCAGG - Intergenic
970966960 4:21939090-21939112 GACATAGCTTTATTTATCCTTGG - Intronic
971207144 4:24581910-24581932 TATAAGGCTTTATTTACTCCTGG - Intronic
972597926 4:40546489-40546511 GTCACAGCTTTATTTATTCTTGG - Intronic
974296667 4:60008912-60008934 AATATACCTTTATTTACTTCTGG + Intergenic
974370472 4:61010388-61010410 GATTTAGCTTTATTTATTCTAGG + Intergenic
974387912 4:61226851-61226873 TATATAGCTTTATTTACTCTGGG - Intronic
974743065 4:66032731-66032753 CACATTGCTTTATCTACTCTTGG - Intergenic
975621157 4:76298267-76298289 GACTTAGCTCAATTTTCTCCTGG + Intronic
977966265 4:103152525-103152547 TACATAGCTTTATTTACTTAAGG - Intronic
981569722 4:146138594-146138616 GACATAATTTTATTTCTTCCAGG + Intergenic
982152938 4:152482702-152482724 GATATTTCTTTATTTACTCATGG + Intronic
983351154 4:166590351-166590373 TATATAGCATTATTTACCCCTGG - Intergenic
983353563 4:166626324-166626346 TACATTACTTTATTTACTGCAGG + Intergenic
984633882 4:182090477-182090499 TCCTTAGCTTTATTCACTCCTGG - Intergenic
988239208 5:28587480-28587502 GACACAGCTTTGTAAACTCCAGG + Intergenic
988446501 5:31291667-31291689 GACATTGCTTTCCTTACTCATGG + Intronic
988612740 5:32742874-32742896 GACATAGATTTTTTTACTTTAGG + Intronic
993354898 5:86893883-86893905 GGTATAGCTTTATATACTTCAGG + Intergenic
993385380 5:87256387-87256409 CATATAGCTTTATTTTCACCAGG - Intergenic
994892174 5:105649971-105649993 GACATAAGTATAGTTACTCCTGG - Intergenic
995901779 5:117077763-117077785 GACATAGCTTTCTTTACCTCTGG + Intergenic
996248051 5:121289764-121289786 TAAATAGCTTTATTTACTTCAGG + Intergenic
996249091 5:121304775-121304797 GTCAAACCTTTTTTTACTCCAGG - Intergenic
997032485 5:130147325-130147347 AACTGAGCTTTATTTATTCCAGG + Intronic
998543627 5:143006747-143006769 GACACATCCTTATTTACTCCAGG + Intronic
998934754 5:147223138-147223160 GACAAAGCCTTATTTTCTGCTGG - Intergenic
1000598734 5:163246782-163246804 GTAATAGCTTTCTTTACTCCAGG - Intergenic
1001844065 5:174904888-174904910 GATAGAGCTCTAATTACTCCTGG + Intergenic
1002049074 5:176559306-176559328 CACATAGCTCCATTAACTCCAGG + Intronic
1003313654 6:4991720-4991742 GAAATAACTTTCTTTAATCCTGG + Intergenic
1005275282 6:24210477-24210499 GAATTATCTTTATTTCCTCCTGG + Intronic
1005899912 6:30208351-30208373 GACACAGCTTTTTCTTCTCCTGG - Intronic
1008269839 6:49478316-49478338 GAAATAGATTTATTTACTGCAGG - Intronic
1008459723 6:51754026-51754048 GACAGAGCTTTAGATATTCCTGG + Intronic
1010150731 6:72729133-72729155 GACATACCATTATTTATTACAGG + Intronic
1010213708 6:73383277-73383299 GACATAGCCTTATTTAGTGTGGG + Intronic
1013801547 6:113951145-113951167 GACATAGCTTTCTCTCTTCCAGG + Intronic
1018293231 6:162314648-162314670 GACATACCTTTACTTACTAGGGG - Intronic
1021224977 7:18015972-18015994 GACAATACTTTATTAACTCCAGG + Intergenic
1022583005 7:31575523-31575545 GTAATAGGTTTATTTACTGCAGG + Intronic
1023304347 7:38808494-38808516 TACATACCTTTATTTATTCTAGG - Intronic
1030926610 7:115464102-115464124 GACACAGCTTTATTTGTTCATGG - Intergenic
1031704062 7:124960233-124960255 GACAAAGCTTTATTTGCTAATGG - Intergenic
1036421045 8:8595719-8595741 GGCATAGCTTTGATTTCTCCTGG + Intergenic
1038136870 8:24795941-24795963 GACATTATTTTATTTACTCCTGG - Intergenic
1039405493 8:37309000-37309022 GCCATAGCTCTCTGTACTCCAGG + Intergenic
1045156718 8:99483428-99483450 TAAATAGCTTTTTTTACTGCAGG - Intronic
1045160778 8:99541650-99541672 GAGATAGATTTATTTACTTTCGG - Intronic
1046850929 8:118972154-118972176 AACATAACTTTTTTTACTCAAGG - Intergenic
1047166260 8:122441776-122441798 AACACAGCTTTATCTACTTCTGG - Intergenic
1048411965 8:134184382-134184404 GAAATATCTTTTTTTCCTCCTGG - Intergenic
1052610841 9:30771733-30771755 AACATAGCTTTATTTAGTTCTGG - Intergenic
1055041483 9:71878393-71878415 GTCTTATCTTTATTTTCTCCTGG - Intronic
1055228493 9:74030869-74030891 CCCATAGCTTCATTTTCTCCTGG - Intergenic
1057364364 9:94405148-94405170 GACATATATGTATTTACTTCTGG + Intronic
1057658967 9:96982920-96982942 GACATATATGTATTTACTTCTGG - Intronic
1060468339 9:123927839-123927861 GACAGAGCTTTGGTTACTACTGG - Intronic
1185542016 X:910086-910108 AGCAGAGATTTATTTACTCCTGG + Intergenic
1186549538 X:10488304-10488326 GACATAGCTTTCCTTTCTCTTGG + Intronic
1188087261 X:25914866-25914888 GAAATAGCTGTATTTGATCCTGG - Intergenic
1194287791 X:92031945-92031967 AAGATAGCTTTGTTTACTCTGGG + Intronic
1200301850 X:154984338-154984360 GCCATAGCTTTTTTTATTCTGGG + Intronic
1200605320 Y:5256505-5256527 AAGATAGCTTTGTTTACTCTGGG + Intronic
1201984939 Y:19955652-19955674 TACTTAGCTTAATTTTCTCCAGG + Intergenic