ID: 917763717

View in Genome Browser
Species Human (GRCh38)
Location 1:178194460-178194482
Sequence CTGGAAGTACAGGAGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917763710_917763717 10 Left 917763710 1:178194427-178194449 CCAACACATCCACCAACTATGCC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG 0: 1
1: 0
2: 1
3: 33
4: 320
917763711_917763717 1 Left 917763711 1:178194436-178194458 CCACCAACTATGCCTCACTTGCC 0: 1
1: 0
2: 2
3: 18
4: 191
Right 917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG 0: 1
1: 0
2: 1
3: 33
4: 320
917763712_917763717 -2 Left 917763712 1:178194439-178194461 CCAACTATGCCTCACTTGCCTCT 0: 1
1: 0
2: 0
3: 22
4: 287
Right 917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG 0: 1
1: 0
2: 1
3: 33
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917763717 Original CRISPR CTGGAAGTACAGGAGAAGCT TGG Intronic
900394445 1:2447428-2447450 CTGGGAGCACAGCAGAACCTGGG - Intronic
900663020 1:3795545-3795567 CTCGATCTACAGGAGAAGCCAGG + Intronic
901046507 1:6399333-6399355 CTGGGAGTACTGGAGAAGAGTGG - Intergenic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
903545603 1:24121621-24121643 CTGGGAGTACTGGACAGGCTGGG + Exonic
904478455 1:30779181-30779203 CTGGAGGAGAAGGAGAAGCTGGG + Intergenic
905283471 1:36864197-36864219 CTGGAAGTTTAGGAGAGGGTTGG + Intronic
905808324 1:40893253-40893275 CAGAAAGTAAAGGAGAAGCAAGG + Intergenic
906407494 1:45553696-45553718 CTAGAAGTATAGGAGAGGCCGGG + Intronic
906902784 1:49854610-49854632 GTGGAGGTGCAGGAGCAGCTGGG - Intronic
907605691 1:55815240-55815262 CTGGAAGTTCAGGAGCAGCATGG - Intergenic
910505932 1:87950320-87950342 GTGGAACTACAGAAGAATCTTGG - Intergenic
910722094 1:90297716-90297738 ATGGAAGGACAGGAAAAGATGGG - Intergenic
911586045 1:99692185-99692207 CTGGAAGTACAAGAATAGGTTGG - Intronic
914773852 1:150717812-150717834 CTGGGATTACAAGAGTAGCTGGG - Intronic
915162276 1:153929139-153929161 GTGGAGGTACTGGAGAAGGTTGG + Intergenic
916021688 1:160798235-160798257 CTGGAAGCCCAGGAGCTGCTGGG - Intronic
916801622 1:168221497-168221519 CTGGAAGTAGAGGGGAGGCCTGG + Intergenic
917027474 1:170659791-170659813 CTGGAGGTCAAGGAGAGGCTAGG + Intergenic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
919763214 1:201111237-201111259 CTGGAAGGACAAGAGAAACGTGG - Intronic
920581739 1:207115317-207115339 CTGGAAGCAGAGGTGAACCTTGG + Intronic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
922424614 1:225481321-225481343 CTGGTATTACAGGAGCACCTGGG - Intergenic
922702899 1:227772059-227772081 CTGGGAGGACAGGAAAGGCTTGG - Intronic
922889216 1:229047446-229047468 CGGGAAGTACCAGAGAAGCTGGG + Intergenic
1063113261 10:3054291-3054313 AGGGAATGACAGGAGAAGCTGGG - Intergenic
1063233045 10:4085097-4085119 TTGGGATTACAGGAGTAGCTGGG - Intergenic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1067797086 10:49328478-49328500 ATGGAAATACAGGAAAATCTTGG - Intergenic
1071208103 10:83307168-83307190 CTGTAAGTACAAGATAAGCCTGG + Intergenic
1071240229 10:83697123-83697145 CAGGAAGTACAGGTGATTCTGGG - Intergenic
1074927016 10:118084087-118084109 CTGGAAGTCAAGCAGATGCTGGG - Intergenic
1076891099 10:133283801-133283823 CAGGAAGTGCAGGAGAGGCAGGG - Intronic
1081714071 11:45236127-45236149 AAGGAGGGACAGGAGAAGCTGGG - Intergenic
1082691352 11:56308360-56308382 CTGGAGCCACAGGAAAAGCTGGG + Intergenic
1082862632 11:57870479-57870501 CTGGGAGTACTGGAGCAGCATGG - Intergenic
1083697157 11:64450447-64450469 CAGGAGGTACAGGAGAATCTGGG - Exonic
1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG + Intergenic
1084442349 11:69181878-69181900 CTCAAAGTACAAGAGAAGCAAGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085122177 11:73974298-73974320 CTGGAACTGCAGGAGATGCAGGG + Intergenic
1085329587 11:75636782-75636804 CAGGAAGTAATGGATAAGCTGGG - Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086782103 11:90920176-90920198 CTGGATGGACAGGAGCAGGTAGG + Intergenic
1087006632 11:93478128-93478150 CTGGAAGTAAAGGTCAGGCTTGG - Intergenic
1088191024 11:107228375-107228397 GAGGGAGTACAGGAGAAGCAGGG - Intergenic
1088350661 11:108883917-108883939 CTGGAAGTAGAAGAGAAGTTAGG - Intronic
1089240462 11:117074103-117074125 GTGGTAGTTCTGGAGAAGCTGGG - Intronic
1089754705 11:120678132-120678154 CTGGAGGTGCAAGAGAAGGTAGG + Intronic
1090099455 11:123778764-123778786 CTGCAGCTGCAGGAGAAGCTGGG - Intergenic
1090612108 11:128480452-128480474 CTGGAGGTAAAGGAGGAGGTAGG + Intronic
1091009153 11:131982485-131982507 CTGAAAGTTCAGGAGCAGCTGGG + Intronic
1091440321 12:507782-507804 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440327 12:507818-507840 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440344 12:507890-507912 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440352 12:507926-507948 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440360 12:507962-507984 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1092030904 12:5284050-5284072 CTGAGAGTACAGCAGAAGATTGG - Intergenic
1094133227 12:27097429-27097451 TTTGAAGTACAGGTGGAGCTGGG - Intergenic
1094596987 12:31874734-31874756 CAGGAAGCACAGGAGATGCAGGG + Intergenic
1094794751 12:33958490-33958512 CTGATCCTACAGGAGAAGCTTGG + Intergenic
1095106601 12:38241117-38241139 CTGATCCTACAGGAGAAGCTTGG + Intergenic
1095730019 12:45496537-45496559 CAAGAAGTACAGGAGAAGACTGG + Intergenic
1096025506 12:48357563-48357585 CTGGGACTACATGAGTAGCTGGG + Intergenic
1096146565 12:49282882-49282904 CTGGGAGTTCAGGACAAGCCTGG - Intergenic
1096322750 12:50629772-50629794 CTAGAAGCACAGGAGCAGGTTGG - Intronic
1097866956 12:64567047-64567069 GAGGAAGTAAAGGAGCAGCTGGG + Intergenic
1099981175 12:89604896-89604918 CTGGAAGTAGGGGTGAAGGTAGG + Intronic
1100371324 12:93971544-93971566 CTGGAAGTAGATTAGGAGCTAGG - Intergenic
1100715850 12:97304367-97304389 CTAGAAGCACAGGATAAGCCAGG + Intergenic
1100842377 12:98626369-98626391 CTGCGAGTAGAGGAGCAGCTAGG - Exonic
1102305873 12:111804116-111804138 CTGGAAGTTCAGGACCTGCTGGG + Intronic
1103009786 12:117449339-117449361 CTGCAAGTACAGGACATGGTGGG - Intronic
1103585115 12:121947326-121947348 CAGGAAGTAGAGGACAAGATGGG - Intronic
1104658780 12:130593544-130593566 CTGGAGGGAGAGGAGAATCTGGG + Intronic
1108152810 13:47553842-47553864 CTGGGAGTACAGGCAATGCTTGG - Intergenic
1108246340 13:48518015-48518037 CTGGAAGTCAAGGAGCAGCAAGG + Intronic
1108974703 13:56424315-56424337 TTGGAAATGCAGGAGGAGCTGGG + Intergenic
1111940568 13:94602187-94602209 CTGGAGGTCCAGGTGAGGCTGGG - Intronic
1112921036 13:104613055-104613077 CAGCAAGTACAGGTGAAACTGGG + Intergenic
1113515502 13:110893176-110893198 CTGGAGGTTCAAGAGAAACTGGG + Exonic
1113625460 13:111793064-111793086 CTGCAGGTACAAGAGAGGCTGGG - Intergenic
1115914957 14:38301855-38301877 CTGGTTGTCCAGGAGAGGCTAGG - Intergenic
1116127618 14:40808270-40808292 ATGCAAGTTCAGGAGAAGTTTGG + Intergenic
1117782626 14:59249884-59249906 CTGGAAGTAGAGGAGAGTTTTGG + Intronic
1121325637 14:93018134-93018156 CTGGAGGCACAGCAGAAGATGGG + Intronic
1122399915 14:101460821-101460843 GTGGGAGCACAGGAGATGCTGGG + Intergenic
1122569874 14:102689354-102689376 GTGGAACTAGAGGGGAAGCTCGG + Intronic
1122685626 14:103504382-103504404 CTGGTAGTTCAGGACCAGCTTGG + Intergenic
1122921026 14:104880200-104880222 CTGGATGGAGAGGAGAGGCTGGG + Intronic
1123666174 15:22610757-22610779 AAGGAGCTACAGGAGAAGCTTGG - Intergenic
1124062207 15:26304683-26304705 CTGGAAGTACATGAGAGGTGTGG - Intergenic
1124319997 15:28705163-28705185 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124482514 15:30090254-30090276 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124488971 15:30142356-30142378 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124521060 15:30406955-30406977 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124537602 15:30559265-30559287 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124544057 15:30611320-30611342 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1124564021 15:30798755-30798777 AAGGAGCTACAGGAGAAGCTTGG + Intergenic
1124754559 15:32395967-32395989 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124761054 15:32448322-32448344 AAGGAGCTACAGGAGAAGCTTGG - Exonic
1124777580 15:32600741-32600763 AAGGAGCTACAGGAGAAGCTTGG + Exonic
1125957205 15:43798817-43798839 CAGCAAGTACACGAGAAGCAGGG + Exonic
1126560309 15:50035956-50035978 CTGGGAGTCCAGGAGTTGCTGGG - Intronic
1126802137 15:52308662-52308684 GAGGAAGTACAGGAGAAGGAGGG + Exonic
1127044642 15:55012802-55012824 CAGGAAGAAAATGAGAAGCTAGG - Intergenic
1127361058 15:58245627-58245649 TGGGAAGTAAAGGAGAAGGTGGG - Intronic
1127542856 15:59959673-59959695 TTGGTAGCACTGGAGAAGCTGGG - Intergenic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128879800 15:71232559-71232581 CTGGAAGTACAGAAGTAGGTAGG + Intronic
1129278555 15:74464730-74464752 CAGGAAGTACAAGATTAGCTAGG - Intergenic
1129350629 15:74954159-74954181 GCTGAAGTCCAGGAGAAGCTAGG + Intergenic
1129736484 15:77968465-77968487 CTGGAAGGCCTGGAGAAGCAAGG - Intergenic
1130566227 15:84998231-84998253 CTGCAAGTATTGGTGAAGCTGGG + Intronic
1131649036 15:94378800-94378822 CTGGACGTACATGAAAAGTTAGG + Intronic
1132119303 15:99162868-99162890 CTGGAAGTTCAAGACCAGCTTGG + Intronic
1132154162 15:99483982-99484004 CTGGAAGTTCAGGACCAGCCTGG - Intergenic
1132321415 15:100928376-100928398 CAGGAAGTCTAGGAGAAGGTGGG - Intronic
1132552958 16:560792-560814 CTCGAAGTCCAGGAGCAGCGCGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135153172 16:20028047-20028069 CTGGAAGTAGGTGAGAAGCAGGG + Intergenic
1135589002 16:23691963-23691985 CTGGAAGAACTGGAGTTGCTTGG + Exonic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136114643 16:28087175-28087197 CTGGAAGGGCAGCAGGAGCTGGG + Intergenic
1136382710 16:29903559-29903581 CTGGCAGCACAGGAGATGATTGG - Intronic
1137468072 16:48729416-48729438 ATGAAAGAAAAGGAGAAGCTTGG - Intergenic
1137841912 16:51648822-51648844 CAGCAAGTAAAGGAGGAGCTTGG - Intergenic
1140931350 16:79631037-79631059 TTGGAAGGAGATGAGAAGCTAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143125619 17:4639594-4639616 GTGGAAGTACCGGAGTATCTGGG - Exonic
1143402858 17:6657229-6657251 GTGGAAGTACCGGAGTACCTGGG + Intergenic
1143995585 17:11003712-11003734 CAGGAAGAACAGGAGAAGCAAGG - Intergenic
1145840196 17:27988308-27988330 TTGGAAGCACAGGAGCAGCATGG - Intergenic
1148452883 17:47791540-47791562 CTGGAAGTGGAGAAGAAGGTAGG - Intergenic
1148649130 17:49237103-49237125 CAGGAAGTACAGGAGGAGCTGGG + Intergenic
1149458908 17:56811443-56811465 CTGGAAGGAAAGGGGAGGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151517046 17:74603279-74603301 GTGGAAGGAAAGGAGGAGCTGGG + Intergenic
1151981183 17:77510197-77510219 CTGACAGCAAAGGAGAAGCTGGG + Intergenic
1154334936 18:13457558-13457580 CAGAAAGGACAGGAGAAGGTTGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155422481 18:25670006-25670028 CTGGTTGAACAGGAGATGCTGGG - Intergenic
1155555120 18:27010541-27010563 CAGGAAGTAGAGGAGGAGTTAGG - Intronic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1157895685 18:51464650-51464672 CTGGGAGGACAGCAGGAGCTTGG + Intergenic
1157913264 18:51639352-51639374 CTGGAAGAACAGTCGAAGATAGG - Intergenic
1161119434 19:2517297-2517319 CTGGGAGTACCTGAGTAGCTGGG + Intronic
1161950845 19:7467096-7467118 CTGAAGGTTCAGGAGCAGCTGGG - Exonic
1162138978 19:8574103-8574125 CTGGAAATTCTGGAGATGCTTGG - Intronic
1162267488 19:9587747-9587769 CTGGAAGTTCAAGAGCAGCCTGG - Intergenic
1162559013 19:11405232-11405254 CTGGAAGGACAGGAGAAGGGTGG + Intronic
1164877637 19:31702790-31702812 CTGGAATGACTGGAGGAGCTAGG + Intergenic
1165023139 19:32940169-32940191 TTGGAAGGAGAGGAGAAGCCTGG - Intronic
1165917748 19:39271002-39271024 CTGGAAGTACAAGAGCAACATGG - Intergenic
1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG + Exonic
1167031662 19:46966051-46966073 CTGGATGTACAAGTGAAGCTAGG - Intronic
1168094632 19:54107688-54107710 CTGGGAGTAGAGGAGAAGGAAGG - Intronic
1168255939 19:55165378-55165400 CTGGAGGAACCGGAGAAGATGGG - Exonic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927259113 2:21069189-21069211 CTGGAAGTACCCAAAAAGCTAGG + Intergenic
927410403 2:22818391-22818413 CAGGAAGTACAGGGGATGGTTGG - Intergenic
927513077 2:23656708-23656730 ATGTGAGTCCAGGAGAAGCTGGG + Intronic
927885446 2:26715562-26715584 CAGGGAGTAGAGGAGAAGCTGGG + Intronic
930916404 2:56694516-56694538 CAGGTAGTACAGAAGAAGATGGG + Intergenic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
931329986 2:61270836-61270858 TAGGAAGTATAGGAGAAACTTGG - Intronic
932064781 2:68543170-68543192 CGGGGAGGACAGGAGGAGCTGGG + Intronic
932465908 2:71923995-71924017 CTGGAAGGAGAGGAGCAGCAAGG + Intergenic
932767494 2:74480803-74480825 CTGGAAGTGGAGCAGCAGCTGGG - Exonic
933575821 2:84066210-84066232 CTAGAATTACATTAGAAGCTGGG + Intergenic
934566018 2:95341710-95341732 CTGGGAGTCCAGGAGAACCAGGG - Intronic
935409057 2:102739634-102739656 GTGGAAGCAAAGGAGGAGCTAGG - Intronic
937020473 2:118646336-118646358 CTGGAATTACAGGAGGAGGTGGG + Intergenic
938150142 2:128875433-128875455 CTGGAAGTATAGGAGCAGGAAGG - Intergenic
938254921 2:129849872-129849894 CTTGAAGTAAGGGTGAAGCTTGG - Intergenic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
940353225 2:152712205-152712227 CTGAAAGTACTGGAGATTCTTGG + Intronic
940405794 2:153300403-153300425 CTGGATGTACAGGGAAAGCTGGG + Intergenic
940477541 2:154183499-154183521 CTGGAAGTTCAAGACAAGCCTGG + Intronic
941383417 2:164823535-164823557 CAGGCTGTACTGGAGAAGCTTGG - Intronic
941456606 2:165717014-165717036 CTGGAAGTAGAGGCCAGGCTTGG + Intergenic
941487073 2:166095536-166095558 CAGGAAGAACAGGAGAATCATGG - Intronic
942329532 2:174807340-174807362 CTGGAAGTAAAACTGAAGCTTGG - Intronic
942367763 2:175246168-175246190 CTGGAAGAAAAGGAAAAGATAGG - Intergenic
945614838 2:212054471-212054493 CTGGAAGGACTGGACAACCTGGG + Intronic
946276097 2:218633019-218633041 CAGAAAGCACAGGATAAGCTAGG - Intronic
946512362 2:220372456-220372478 CATGAAGTACAAGAGAGGCTGGG - Intergenic
948496474 2:238353188-238353210 CTAGAAGAAGAGGAGAAGCATGG + Exonic
1170475266 20:16708007-16708029 CTGGGAGTACGGGAGGATCTGGG - Intergenic
1172887459 20:38240831-38240853 CTGCAGCTGCAGGAGAAGCTGGG + Exonic
1174755493 20:53154427-53154449 CAGGAAGTTGACGAGAAGCTGGG - Intronic
1175609786 20:60340904-60340926 CTGGACCTAGAGGAGAAGGTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178576546 21:33797521-33797543 CAGGAAGCACAAGACAAGCTGGG + Exonic
1178970136 21:37167133-37167155 CTGGTTTGACAGGAGAAGCTGGG - Intronic
1179228309 21:39476228-39476250 ATGGAAGCCCAGGAGGAGCTTGG + Intronic
1179826783 21:43970648-43970670 CTCGCAGTACAGGAGAAACTAGG - Exonic
1179895643 21:44360937-44360959 GAGGAAGTACAGGAAGAGCTCGG - Intronic
1180641869 22:17305333-17305355 TTCGGAGAACAGGAGAAGCTAGG + Intergenic
1180675356 22:17582540-17582562 CTGGAAGTGAAGGACAAGATGGG - Intronic
1180703085 22:17792357-17792379 CAGGAAGCCCAGGAGCAGCTTGG - Intronic
1180745858 22:18088430-18088452 CTGGAAGTTCAGAAAAAGCCTGG + Exonic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181318198 22:21984847-21984869 CTGGAGGGAGAGGAGGAGCTCGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184710412 22:46246349-46246371 CTGGTGGTCCAGGAGAAGCTGGG - Intronic
949518362 3:4827218-4827240 CTGGAAGTAAAGGGCAAGCCGGG - Intronic
950576013 3:13832454-13832476 GAGGAAGAGCAGGAGAAGCTTGG - Intronic
950833421 3:15897490-15897512 CTGTAAGTTCAGGAGAACCCAGG - Intergenic
954160779 3:48720235-48720257 CTGGGACTACAGGTGTAGCTGGG - Intronic
954379782 3:50213319-50213341 CTGGCAGTGGAGGAGAGGCTTGG + Intronic
955601045 3:60645316-60645338 CTGGAAGGCCAGGAGAAGAGGGG - Intronic
956040869 3:65143687-65143709 TTGAAAGTTCAGGAGAAGATGGG - Intergenic
956096331 3:65720526-65720548 CTAGAAGTACAGGCTAAGATGGG - Intronic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
956442790 3:69296478-69296500 CTGGAAGTTCAGAATAGGCTGGG + Intronic
958777442 3:98503220-98503242 CTGGAAGACCAGGGGCAGCTGGG + Intronic
960804009 3:121565335-121565357 CTGAAAGTTCAGGAGAGGCTGGG + Intergenic
960992932 3:123323555-123323577 CAGGAAGTGGAGGGGAAGCTGGG - Intronic
961737780 3:129013051-129013073 CTGGAGCTACAGGACAAGCCAGG - Intronic
962088444 3:132217320-132217342 CTGTAATTACTGGAGCAGCTTGG + Intronic
962412351 3:135152381-135152403 CTGGGGGTACAGCAGGAGCTTGG + Intronic
963240092 3:142994502-142994524 ATGGAAACACAGGAGAAGATTGG - Intronic
963438099 3:145298136-145298158 TTGTAACTACAAGAGAAGCTGGG - Intergenic
965770898 3:172180189-172180211 CTGGAAGGACAGCAGAAGCATGG - Intronic
966625629 3:182013362-182013384 CTGGAAGGGCAGGAGAATATAGG - Intergenic
967265969 3:187692600-187692622 CAAGAAGTCCAGGAGAAGCTTGG - Intergenic
967739446 3:192988944-192988966 CTGTAAGTAAATGAAAAGCTTGG + Intergenic
968052056 3:195661624-195661646 CTGGATGCACAGGAGCACCTGGG + Intergenic
968103756 3:195986714-195986736 CTGGATGCACAGGAGCACCTGGG - Intergenic
968302058 3:197624307-197624329 CTGGATGCACAGGAGCACCTGGG - Intergenic
969135862 4:5028259-5028281 CTGGGACTACAGGAGTAGCTGGG + Intergenic
969150860 4:5167444-5167466 GGGGGAGCACAGGAGAAGCTGGG - Intronic
969220231 4:5754332-5754354 CTGCAAGTCCAGGAGAAGGAAGG + Intronic
969498045 4:7537286-7537308 CTGGGAGACCAGGAGAAGCTAGG - Intronic
969993933 4:11292522-11292544 CTGGGAGTACATCAAAAGCTGGG - Intergenic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
970956967 4:21824158-21824180 CAGGAATAACAGGAGCAGCTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974828686 4:67162362-67162384 CTGAAAGAAAAGGAGAAGCTAGG - Intergenic
975238590 4:72030252-72030274 CTGAAAGTACGGGAGAGGGTGGG + Intergenic
979389571 4:120112238-120112260 CTGTAAGGACAGGGGAAGCAAGG + Intergenic
980663074 4:135892834-135892856 ATGTAAGTATAGGAGAAACTTGG + Intergenic
982886187 4:160785520-160785542 CTGTAAGAAAAGGAGATGCTAGG - Intergenic
983036661 4:162875218-162875240 CTGGAAGTACAACAGATGCCTGG + Intergenic
984411418 4:179403493-179403515 CAGCAAGTACAGTGGAAGCTGGG - Intergenic
985498254 5:223356-223378 CTGGATGCACAGGAGCACCTGGG + Intronic
986029190 5:3879918-3879940 CTGAAAGCACAGGAGAAGATGGG - Intergenic
986319395 5:6615678-6615700 CTGGAAGGACAGCAGCAGGTGGG + Intronic
986734724 5:10660424-10660446 CTGGAAGTACAGGTGATGTGAGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990660220 5:58005700-58005722 TAGGAAATACAGGACAAGCTTGG - Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
994184954 5:96807266-96807288 CCAGAAGAACAGGAGAAGCAGGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994764368 5:103898853-103898875 TTGGAAGAACAGGTGAAGATGGG - Intergenic
995287056 5:110401672-110401694 CTTGACCTACATGAGAAGCTGGG - Intronic
997414944 5:133719866-133719888 TTGGAAATACAGGATAAGATTGG + Intergenic
997558500 5:134822565-134822587 GTGGGAGTACAAGAGAAGCCAGG - Intronic
997950739 5:138240973-138240995 GTGGGAGGACAGGAGAAGCTAGG - Intergenic
998099562 5:139421099-139421121 ATGGAAAAACATGAGAAGCTGGG + Intronic
998315299 5:141177864-141177886 CTGGAAGTCCACGGGGAGCTTGG + Exonic
998319225 5:141213952-141213974 CTGGAAGTCCACGGGGAGCTTGG + Exonic
998515644 5:142751385-142751407 CTGGAAGTGCAGGCTCAGCTGGG + Intergenic
998680473 5:144461223-144461245 ATGGAATTACAGGAAAAGCATGG + Intronic
998837468 5:146216865-146216887 CTAGAAGTTCAAGAGCAGCTTGG - Intronic
1001210673 5:169807460-169807482 CTGGAAATAGAGGAATAGCTGGG + Intronic
1002200670 5:177526036-177526058 CTGGAAGTACAGGAGGCAGTGGG - Intronic
1003548383 6:7080567-7080589 CTGGTAGTGCAGGAGAAACTCGG + Intergenic
1003976519 6:11350182-11350204 CTGGATGTACATGAAAAGATTGG - Intronic
1004461947 6:15845350-15845372 CTAAAAGTACAAGAGGAGCTTGG - Intergenic
1004641491 6:17520474-17520496 CTGGAGGTTCAGGAGAGGCTAGG - Intronic
1006186192 6:32182900-32182922 CTGAAGCTACAGGAGAAGGTGGG + Exonic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1006447819 6:34089816-34089838 CTGGAGGGACAGGAGAGGCATGG - Intronic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007159005 6:39773919-39773941 CTGGGAGAAAAGGAGAAACTTGG - Intergenic
1007330758 6:41105969-41105991 CTGGAGATACAGGAGAAATTTGG + Intergenic
1007994971 6:46297400-46297422 CTGGAGGTTCAGGAAAAGCTTGG - Intronic
1008766650 6:54925214-54925236 CTGGAAATTCAGGAGGAGTTTGG - Intronic
1009833537 6:68969512-68969534 CTGTCAGTACTGGAGAAGCATGG + Intronic
1010824908 6:80461223-80461245 CAGGAAGAATAGGAGAAGCAGGG - Intergenic
1010922731 6:81704059-81704081 ATGGCAGTGCAGGTGAAGCTGGG - Intronic
1012989582 6:105911511-105911533 CTGGCAGTACAGCAGAAGCCAGG + Intergenic
1013145640 6:107388572-107388594 CTGGGACTACAGGAGTAGGTGGG + Intronic
1015227010 6:130869478-130869500 CTGGGAGGACAGGAGAAGAAAGG + Intronic
1015898532 6:138040285-138040307 CTGGTATTACATCAGAAGCTGGG + Intergenic
1017503971 6:155050621-155050643 CTGCAAGGAAATGAGAAGCTAGG - Intronic
1017727865 6:157288012-157288034 TTGGAAAGACAGGAGAACCTGGG + Intergenic
1017970395 6:159307338-159307360 CTGGGATTACAGGAGAGGCCAGG + Intergenic
1018297231 6:162361793-162361815 CTGGAAGTACGTGAGCAGATAGG - Intronic
1018617491 6:165701996-165702018 CTGGAACTACAGGACAAGTGGGG + Intronic
1019274022 7:166525-166547 CTGGAGGAACAGGAACAGCTGGG + Intergenic
1021096841 7:16544762-16544784 CTGGAAGTACGACAGTAGCTTGG + Intronic
1022506988 7:30913603-30913625 CTGGCAGCCCAGGAGAGGCTAGG + Intronic
1022752591 7:33245978-33246000 CTGGAGGTACTGGAGTATCTTGG + Intronic
1022903956 7:34837938-34837960 CTGAAAGTACAGGAAGACCTTGG - Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024925260 7:54605788-54605810 CTGGAGATGCGGGAGAAGCTTGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1032553337 7:132806044-132806066 CAGAAAGGACAGCAGAAGCTTGG + Intronic
1032644532 7:133808015-133808037 CTGGAAGTAGAGGAGAAAAGAGG - Intronic
1034198341 7:149264936-149264958 CTGGAAGTAGGGGAGAAGGCTGG + Intronic
1034648653 7:152671650-152671672 CTGGAATTCCAGGATAAGGTTGG + Intronic
1034959034 7:155352804-155352826 CTGGGAGAACAGGGGAAGCCTGG + Intergenic
1036068696 8:5415228-5415250 CTGTGAGCACAGGAGGAGCTGGG + Intergenic
1036523974 8:9518284-9518306 TTGGAAGCACAGGAGAAACAAGG + Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038259869 8:25983602-25983624 CTGGAATGACAGGAAAAGCCAGG + Intronic
1042407351 8:68421482-68421504 CTGGATGTACAGTAGGAGTTGGG - Intronic
1042508378 8:69585460-69585482 CGGGAAGCAAAGAAGAAGCTGGG - Intronic
1042551837 8:70001160-70001182 CTGGAAGTTCAAGAGCAGCCTGG + Intergenic
1043307931 8:78820241-78820263 CTGGAAATAAAGGACAGGCTGGG + Intergenic
1043377729 8:79669030-79669052 CTGGAAGTAGAAAAGAAGCAAGG - Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044769910 8:95620394-95620416 CAGGAAGTAGATGAGGAGCTAGG + Intergenic
1045814690 8:106266255-106266277 CTGGAAGTATACCAGATGCTTGG + Intergenic
1045817437 8:106293201-106293223 CTGTAACAACATGAGAAGCTTGG + Intronic
1046529194 8:115421707-115421729 CTGGAAGTAGCAGAGAAGGTGGG + Intronic
1047268467 8:123331054-123331076 CTGGGATTACAGGAGGAGCTGGG + Intronic
1049499247 8:142952709-142952731 CTGGGAGTAGAGGGGAACCTGGG - Intergenic
1049717280 8:144098972-144098994 CAGGAAGGACAGGACCAGCTGGG + Exonic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051720358 9:20030398-20030420 ATGGTTGTACAGGAGGAGCTCGG - Intergenic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057495297 9:95555599-95555621 CAGGAAGTAAGGGAGAAGCCCGG - Intergenic
1057631276 9:96720746-96720768 CTGCCAGTGCAGGAGGAGCTAGG - Intergenic
1058495548 9:105554968-105554990 TGGGAAGTACAGATGAAGCTTGG + Intergenic
1059725947 9:117008177-117008199 CTGGTAATACAGGGAAAGCTTGG + Exonic
1060278994 9:122203490-122203512 CTAGAATTACAGGATAAGCTTGG + Exonic
1062245946 9:135566120-135566142 ATGGAAGGGCATGAGAAGCTGGG + Intronic
1062252650 9:135606019-135606041 CTGGGATTACAGGTGTAGCTGGG + Intergenic
1062354264 9:136154355-136154377 CTGGAAGGACAGGAGAGACTGGG - Intergenic
1062354311 9:136154496-136154518 CTGGAGGGACAGGAGAGACTGGG - Intergenic
1062354324 9:136154548-136154570 CTGGAGGGACAGGAGAGACTGGG - Intergenic
1062354338 9:136154600-136154622 CTGGAGGGACAGGAGAGACTGGG - Intergenic
1062354352 9:136154652-136154674 CTGGAGGGACAGGAGAGACTGGG - Intergenic
1062730355 9:138105056-138105078 CTGGAAGGACAGGAACAGATGGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186299520 X:8184381-8184403 CTGGATGGCCAGGAGAACCTGGG + Intergenic
1187229751 X:17409484-17409506 CTGGAAGGTCAGGATAAGCTGGG + Intronic
1189344757 X:40232555-40232577 CTGGAAGTAAAGGTGAAACCAGG - Intergenic
1194230086 X:91311086-91311108 TGGGAAGTATATGAGAAGCTGGG + Intergenic
1195533740 X:105986694-105986716 CTGGGAGTTCAAGAGCAGCTTGG + Intergenic
1196810591 X:119626082-119626104 CTGGAAGTACAGAAGAAGACAGG + Intronic
1197055910 X:122118453-122118475 CTGGAATTTCAGGATAAGTTGGG - Intergenic
1198745217 X:139882905-139882927 GTGGAAGTGTAGAAGAAGCTGGG + Intronic
1199853896 X:151744286-151744308 GTCGACGTGCAGGAGAAGCTAGG + Exonic
1199984905 X:152943495-152943517 CAGGAAGTTCATGAGGAGCTCGG + Intronic
1200036005 X:153330899-153330921 CTGTAGCTACAAGAGAAGCTGGG + Intergenic
1200767902 Y:7096068-7096090 CTTGAAGCACAGGTGAAGCAGGG + Intergenic
1200871070 Y:8099039-8099061 CAAGAGGTACAGGAGGAGCTGGG - Intergenic