ID: 917764138

View in Genome Browser
Species Human (GRCh38)
Location 1:178199004-178199026
Sequence GTGTCCACCATTACTTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917764138_917764145 16 Left 917764138 1:178199004-178199026 CCTACTCAAGTAATGGTGGACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 917764145 1:178199043-178199065 GGCTGCCCTGCAGTTCGATCTGG 0: 1
1: 0
2: 4
3: 11
4: 86
917764138_917764139 -9 Left 917764138 1:178199004-178199026 CCTACTCAAGTAATGGTGGACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 917764139 1:178199018-178199040 GGTGGACACCTCCTCCAGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 244
917764138_917764140 -5 Left 917764138 1:178199004-178199026 CCTACTCAAGTAATGGTGGACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 917764140 1:178199022-178199044 GACACCTCCTCCAGCCAGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 294
917764138_917764146 17 Left 917764138 1:178199004-178199026 CCTACTCAAGTAATGGTGGACAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 917764146 1:178199044-178199066 GCTGCCCTGCAGTTCGATCTGGG 0: 1
1: 9
2: 47
3: 79
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917764138 Original CRISPR GTGTCCACCATTACTTGAGT AGG (reversed) Intronic
903363098 1:22789391-22789413 GTGGCCACCATTCCTGGTGTGGG + Intronic
909520478 1:76562586-76562608 CTGTCCACCATCTCCTGAGTTGG + Intronic
909564307 1:77037937-77037959 AGGTGCACCATTACTTGAGATGG + Intronic
917764138 1:178199004-178199026 GTGTCCACCATTACTTGAGTAGG - Intronic
918088922 1:181270978-181271000 GTGTCAACTATTACTGAAGTAGG + Intergenic
1071150458 10:82628428-82628450 GTGTTAACCATTATTTGAGTTGG + Intronic
1071704002 10:87976974-87976996 GTATCCAACATTACTTAACTAGG + Intergenic
1072316870 10:94211848-94211870 GTCTCCACCAGTAGTTCAGTAGG - Intronic
1081756339 11:45547532-45547554 ATGTCCACCATGAAGTGAGTGGG + Intergenic
1085541458 11:77274343-77274365 GTGACCACCAATACTGGAGGTGG + Intronic
1098788089 12:74785050-74785072 GTGTCCACGGACACTTGAGTTGG + Intergenic
1118616291 14:67576515-67576537 GTGGCCACCACTGCTTGGGTTGG + Intronic
1124991496 15:34678527-34678549 GGGTCCTACATTACTTGAGAAGG - Intergenic
1124992778 15:34692339-34692361 GTGTTCACCAATAATTGAGGTGG + Intergenic
1125706592 15:41742674-41742696 GTGACGACCATTACTGGAGAAGG - Exonic
1148149794 17:45389817-45389839 GTGTCCACCATTCCGGGAGGTGG + Intergenic
1149426006 17:56555401-56555423 GTGTCCATCAGTAGTTCAGTAGG + Intergenic
1149807847 17:59636287-59636309 GTATCCATCCTTACTTGAGAGGG - Intronic
1161573607 19:5043593-5043615 GTGTCCACCATATCCTGCGTGGG + Intronic
1164779449 19:30880737-30880759 GTGTGACCCATGACTTGAGTGGG - Intergenic
1165687175 19:37831787-37831809 GTGTGGACCATTGCTTGAATGGG + Intergenic
927391847 2:22604977-22604999 GTGTCCATCACTGCTTCAGTTGG - Intergenic
942266433 2:174231121-174231143 GTGTTACCAATTACTTGAGTAGG - Intronic
946625542 2:221608658-221608680 ATGTCCACCAGTAATAGAGTAGG - Intergenic
948072074 2:235135779-235135801 GTCTCCCCCATTTCTTGAGGTGG + Intergenic
1170347801 20:15406259-15406281 GTGTCCAGCATTATTTTATTGGG + Intronic
1173701205 20:45073463-45073485 CTGTCTACCCTTCCTTGAGTGGG - Intronic
1175220820 20:57415387-57415409 GTGTACACCAGGACTTGAGGCGG - Intergenic
1180647188 22:17348819-17348841 GTGTCCTAGATTACTTGTGTTGG - Intergenic
1183648940 22:39142802-39142824 GGGTCCACCATTACATGCGCAGG - Intronic
949498642 3:4657125-4657147 ATGTCCAGCATTAATTGAGAGGG - Intronic
950527716 3:13534198-13534220 CTGTCCCCCATTGCTTGAGAGGG + Intergenic
953293934 3:41694330-41694352 GTGTCCACACATAATTGAGTAGG + Intronic
956562650 3:70597767-70597789 GTCACCACCATTTCTTTAGTTGG + Intergenic
962304108 3:134270643-134270665 GTATCCACCATGACCAGAGTTGG + Intergenic
983743337 4:171163084-171163106 CTGTCCACCTTCACTTTAGTGGG + Intergenic
985654477 5:1122807-1122829 GTGTCCATCAGCACATGAGTGGG - Intergenic
993340703 5:86721851-86721873 ATGTCCAGCATTAGTGGAGTAGG - Intergenic
993485786 5:88483239-88483261 ATGTTCTCCATTACCTGAGTTGG - Intergenic
1000780691 5:165476939-165476961 GTGTCCACCTTTAGTCCAGTGGG + Intergenic
1006611496 6:35296946-35296968 GTGACCACCATTCCTGGTGTGGG + Intergenic
1018415654 6:163600236-163600258 GTGTCGCCCATTATTTCAGTTGG + Intergenic
1026627136 7:72005240-72005262 GTGTCCATCAACACGTGAGTGGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1037214768 8:16436001-16436023 GGGTCCACCATAAGTTGAGAAGG - Intronic
1038674625 8:29612582-29612604 ATGTCCACAAGTACATGAGTAGG - Intergenic
1043742167 8:83828014-83828036 GTGTCCACCATTATTGTATTAGG + Intergenic
1057139854 9:92719789-92719811 GTGACCACCATTACTGGTGACGG - Intronic
1058393997 9:104528655-104528677 TTTTCCACCCTTACTTGTGTTGG - Intergenic
1058932088 9:109730828-109730850 ATCTCCACCCTTGCTTGAGTAGG - Intronic
1061008258 9:127940700-127940722 GTTGCCACCACTGCTTGAGTGGG - Exonic
1201493114 Y:14564449-14564471 GAGTCCACCATTGCTTGAGTAGG + Intronic