ID: 917767126

View in Genome Browser
Species Human (GRCh38)
Location 1:178233038-178233060
Sequence CTCTGATGATACTTTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917767123_917767126 27 Left 917767123 1:178232988-178233010 CCTACTGCAGGAAGTGAGGTGAT 0: 1
1: 0
2: 1
3: 22
4: 168
Right 917767126 1:178233038-178233060 CTCTGATGATACTTTGCTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 173
917767125_917767126 4 Left 917767125 1:178233011-178233033 CCTTTGGAAATCTTGACTTTGTC 0: 1
1: 0
2: 1
3: 18
4: 207
Right 917767126 1:178233038-178233060 CTCTGATGATACTTTGCTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917767126 Original CRISPR CTCTGATGATACTTTGCTTC AGG Intronic
900524611 1:3122435-3122457 CTTTGAAGAGACATTGCTTCAGG - Intronic
900641830 1:3691248-3691270 CTCTGATGCTCCTTGGCTTTGGG + Intronic
906833616 1:49059965-49059987 CTCAGATGACACTTTGTTCCTGG + Intronic
908029573 1:59985503-59985525 CTCTATTGATACTTTGATTTTGG + Intergenic
911018600 1:93363437-93363459 CCCTGCTGATACTTTGATTTAGG - Exonic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
916270749 1:162938865-162938887 CTCAGAGGGGACTTTGCTTCAGG + Intergenic
917767126 1:178233038-178233060 CTCTGATGATACTTTGCTTCAGG + Intronic
918527086 1:185476735-185476757 CTCTCATGACACTTTGATTCTGG - Intergenic
919218485 1:194592781-194592803 TTCTGGTGATACTTTACTTTTGG - Intergenic
920223160 1:204419172-204419194 CACTGATCATACTTTTCTTTAGG + Intergenic
921409082 1:214815279-214815301 CTATGATGCTACGTTGCTGCTGG + Intergenic
923720832 1:236465261-236465283 CCCTGAGGATACCCTGCTTCAGG + Intronic
924641821 1:245840327-245840349 TTCTGATGCTTCTTGGCTTCTGG - Intronic
924866642 1:247989925-247989947 TTCTGATGATAAAATGCTTCAGG - Intronic
1065874361 10:29984001-29984023 CTGTGATGATTCTTTGTTTTTGG + Intergenic
1070637733 10:78142600-78142622 CTCAGATGAGACTTTGTTCCTGG + Intergenic
1070864752 10:79701058-79701080 ATTTGAGGATACTTTGCTTTAGG - Intergenic
1070878539 10:79839186-79839208 ATTTGAGGATACTTTGCTTTAGG - Intergenic
1071645096 10:87355496-87355518 ATTTGAGGATACTTTGCTTTAGG - Intergenic
1072040848 10:91604891-91604913 ATCTGATAAGACTTTGCTACAGG - Intergenic
1074271525 10:111958414-111958436 CTCTCATCATAATTTGCTCCAGG + Intergenic
1076032066 10:127167932-127167954 CTTTGAGGTTACTTTGCTACTGG - Intronic
1077715557 11:4576489-4576511 CTCAGCTGCCACTTTGCTTCTGG - Intronic
1080603102 11:33840060-33840082 CCCTGATGATGCTTTGATGCTGG + Intergenic
1081685080 11:45036746-45036768 CTCTGATGACATTTTTCTTCAGG - Intergenic
1081926413 11:46833095-46833117 CTCTTATTGTACTTTGCCTCAGG - Intronic
1085376093 11:76062027-76062049 CCCTGATGACACTTTGATTTTGG - Intronic
1086801101 11:91176400-91176422 CTAGAATGATACTTTCCTTCTGG + Intergenic
1087542000 11:99532392-99532414 CTCAGATGAGACTTTGTTTTGGG + Intronic
1087973859 11:104519321-104519343 ATCTGCTGATACTTTGCTTTTGG - Intergenic
1088017550 11:105079103-105079125 ATCTAATGATCCTTTGATTCTGG + Intronic
1088140602 11:106611517-106611539 CTCTGTTAAAAGTTTGCTTCTGG - Intergenic
1088245268 11:107812304-107812326 CTCTGATGATACTTTAACTAGGG - Intronic
1088358611 11:108968541-108968563 CTCTGCTGATGCTTTGCTTTTGG + Intergenic
1088387430 11:109275278-109275300 CTTTGATGTGACTTGGCTTCAGG + Intergenic
1092584718 12:9887377-9887399 ATCTGATGCTAATTTGCTTTGGG - Intronic
1093167297 12:15819315-15819337 TTTTGATGATGCTATGCTTCTGG + Intronic
1093274036 12:17101657-17101679 CTCTGATGATAGTTTCTTTTGGG - Intergenic
1097034663 12:56115626-56115648 CTCTAGTGATATTTTGCTTCGGG + Intergenic
1097053403 12:56236878-56236900 TTCTGAGGAGACTTTTCTTCTGG + Intronic
1098694503 12:73536069-73536091 TTCTAATGATGCTTTTCTTCTGG + Intergenic
1101263771 12:103063478-103063500 CTCTGATGAAACTTTTTTGCTGG + Intergenic
1102542278 12:113630067-113630089 CACTGATGATACCTTGATTCTGG - Intergenic
1102863384 12:116355494-116355516 CTCTGATGCTGCCTTGCTCCAGG - Intergenic
1105045074 12:132996112-132996134 CTCTACTGGTACTTTGTTTCTGG + Intronic
1105745851 13:23376104-23376126 TTCTGATCTTACTTTGCTGCTGG - Intronic
1106668770 13:31882168-31882190 CACTGAAGATGCTGTGCTTCAGG - Intergenic
1108465367 13:50709669-50709691 CTCTAAGGCTTCTTTGCTTCAGG - Intronic
1108684312 13:52805475-52805497 TTCTGATGCTCCTTTGTTTCTGG + Intergenic
1108927035 13:55763294-55763316 CTTTGATGATACTTGGATTCAGG + Intergenic
1109963596 13:69663033-69663055 CTCTGATGATACCTTGCAAAAGG - Intergenic
1110167082 13:72455841-72455863 CTCTTATGAAATTTTGCTTGAGG + Intergenic
1111828937 13:93302148-93302170 CTGTGAGGATACTTTTTTTCTGG + Intronic
1112752325 13:102596233-102596255 CTCTGCTGATCCTTAGCTTCCGG - Intergenic
1112942873 13:104887476-104887498 CTTTGATAATAATGTGCTTCTGG + Intergenic
1116659515 14:47691251-47691273 CTCTGACAATAATTTACTTCAGG - Intergenic
1120052879 14:79888670-79888692 CTCTCCTGATGCTTTCCTTCCGG + Intergenic
1120130164 14:80797144-80797166 CCCTGAAGTTACTTTGCTTCTGG - Intronic
1122703694 14:103607168-103607190 CCCTGCTGACACTTTGATTCCGG + Intronic
1123805712 15:23870130-23870152 CTATGAAGAAATTTTGCTTCTGG - Intergenic
1127134498 15:55905584-55905606 CTCTGAGAATATTTTACTTCGGG - Intronic
1127321139 15:57847561-57847583 CCCTGATGATAGTATGATTCTGG + Intergenic
1129643619 15:77409285-77409307 CACACATGATACTATGCTTCAGG + Intronic
1130330768 15:82920572-82920594 CTTTGAAGATGCTTTGCTGCAGG - Intronic
1130729185 15:86472958-86472980 CTGTGATTAAACTTTGATTCTGG - Intronic
1132174908 15:99705036-99705058 TTCTGATTATATTTTGGTTCTGG - Intronic
1133614764 16:7465675-7465697 CCCTGGGGATCCTTTGCTTCTGG + Intronic
1144078876 17:11744275-11744297 CACTGCTGATACTAGGCTTCAGG - Intronic
1147023403 17:37558387-37558409 CTCTAATGAGAATTTCCTTCTGG - Intronic
1148562493 17:48613906-48613928 CCCTGAAGAAACTTTTCTTCTGG - Intronic
1149540147 17:57462479-57462501 CTCTGACAAAACTTTTCTTCTGG + Intronic
1150946252 17:69749218-69749240 TTCTAATGATACTTATCTTCAGG - Intergenic
1154406192 18:14093618-14093640 CTCTGAACATACTCTGGTTCTGG - Intronic
1154959105 18:21290061-21290083 CTATGCTGTTACTTGGCTTCTGG + Intronic
1157370576 18:47107482-47107504 CTCTGATGTTAATGAGCTTCGGG - Exonic
1158491900 18:57917740-57917762 CCCTGATGATCTTTTGCCTCTGG - Intergenic
1158511257 18:58092513-58092535 TTCTGATGAGACTTTGATTTGGG + Intronic
1160061771 18:75535299-75535321 CCCTGACCATCCTTTGCTTCTGG - Intergenic
1167725171 19:51207046-51207068 CTCAGAAGATACCTTGATTCTGG + Intergenic
925845705 2:8031510-8031532 CCCTGCTGACACTTTGCTTTTGG - Intergenic
926944475 2:18171736-18171758 CTCTGATGATATGTGGCATCTGG + Intronic
928079326 2:28295384-28295406 CTCTCATGGTACTTTTCTGCTGG + Intronic
929328667 2:40651286-40651308 CTCTGGTGTTAATTTGCTTAGGG - Intergenic
929676237 2:43933398-43933420 CTCAGATTATACTTCGCTTTTGG - Intronic
930739885 2:54820603-54820625 AGCTGATGTTAGTTTGCTTCAGG - Intronic
934499336 2:94842746-94842768 CTCTAATGAGACTCTGCTACTGG + Intergenic
935593019 2:104857815-104857837 CTTTGAGGATACTTTTCTTTTGG - Exonic
935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG + Intronic
936171309 2:110178510-110178532 CTCTGATTATAGTTTGCAACAGG + Exonic
937529036 2:122806651-122806673 CTCTGATGACACTTTGATTTTGG - Intergenic
937735212 2:125279683-125279705 CTCTGATGATACCTTCCTGGGGG - Intergenic
940345964 2:152628847-152628869 CTCTGAAGATACTAGTCTTCTGG + Intronic
940367771 2:152867742-152867764 CTCTGATGGTACTTCCCTTCAGG + Intergenic
945204085 2:207313232-207313254 CTCTCTTGATACATTGCTTCAGG - Intergenic
945310952 2:208312739-208312761 CTCTGATGATAAATTTCTTTTGG + Intronic
1169425136 20:5490791-5490813 CTCGAGTGATGCTTTGCTTCTGG + Intergenic
1171502164 20:25602262-25602284 CCCTTATGAGACTTTGTTTCAGG + Intergenic
1173284747 20:41660084-41660106 AGCTGATGATTCTTTGCTCCTGG + Intergenic
1173398497 20:42702989-42703011 CTCTGATCATACCCTGCTGCTGG - Intronic
1173952144 20:47001729-47001751 CTCTGAGGACACTCTGCTCCAGG - Intronic
1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG + Intergenic
1179227965 21:39472686-39472708 CCCTGATTCAACTTTGCTTCTGG - Intronic
1183864866 22:40696000-40696022 CTCTGAGGTTCCTTTGCATCAGG - Intergenic
1184670934 22:46012026-46012048 CTCACATGAATCTTTGCTTCAGG + Intergenic
949419168 3:3846793-3846815 CTCAGAGGATATTTTGCTTCTGG + Exonic
952096420 3:29960069-29960091 CTCTGATGAGACTTTGGATTTGG - Intronic
952421964 3:33140713-33140735 TTCTGATGGTTGTTTGCTTCAGG + Intronic
953179960 3:40585813-40585835 CTCTCATGAAACTGTGCTTTAGG - Intergenic
955864549 3:63369254-63369276 CTCTGCTGACACTTTGATCCTGG + Intronic
957131452 3:76227515-76227537 CTGTGATGATGCTTAGCATCAGG + Intronic
957333135 3:78792007-78792029 CTGTGATGTTACATTGCTTCAGG + Intronic
959213592 3:103420822-103420844 CTCTGATTATACTCTCTTTCTGG - Intergenic
960246901 3:115409726-115409748 CTCGGCTGTTCCTTTGCTTCAGG - Intergenic
960332406 3:116377940-116377962 CTCTGATAATACTTTGCCCCAGG + Intronic
967393820 3:188983930-188983952 CCCTGATGATACCTTGGTTTGGG + Intronic
969079337 4:4606425-4606447 CTCTGCTGACACCTTGATTCTGG - Intergenic
973022061 4:45216134-45216156 ATCTGATTTTATTTTGCTTCTGG + Intergenic
973140312 4:46759380-46759402 CTCTGATGATAGTTTCTTTTAGG - Intronic
974589975 4:63934129-63934151 CTCTGATGATTGTTTTCTTTCGG - Intergenic
974669474 4:65010289-65010311 CTCTAATGATCATTTCCTTCAGG - Intergenic
977648886 4:99446437-99446459 TCCTGATGATACTTTGATTTTGG + Intergenic
980589480 4:134866401-134866423 CTCTGATGGGAGTTTGCTACTGG + Intergenic
980654513 4:135765366-135765388 CTCAGATGATACTTTGGCTTTGG - Intergenic
981673282 4:147312046-147312068 CTCTGAGAATAGTTTACTTCTGG - Intergenic
982402986 4:154988915-154988937 CTCAGATTAAACATTGCTTCTGG - Intergenic
985198058 4:187453630-187453652 TTCTTATGTTAATTTGCTTCAGG - Intergenic
986048245 5:4061898-4061920 CTCTGATGATACATTGATCTTGG + Intergenic
986363265 5:7002826-7002848 TTCTTATAAAACTTTGCTTCTGG + Intergenic
986800296 5:11253120-11253142 CACTGATGATTTTTTTCTTCAGG - Intronic
987778720 5:22403593-22403615 CATTGGTGATACTTTGGTTCTGG - Intronic
987948408 5:24645204-24645226 CTCTGATAATACTTGGATTTCGG - Intergenic
990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG + Intergenic
990706519 5:58535965-58535987 CTCTGCTGACACTTTGATTTTGG - Intergenic
990926949 5:61036817-61036839 CTCTAATGTTACTGTCCTTCTGG + Intronic
990970769 5:61503197-61503219 TTCTGATGTTAATTTGCTTCAGG + Intronic
993989757 5:94641687-94641709 CTCTGTTGTTACTCAGCTTCAGG + Intronic
995531065 5:113092277-113092299 CTCTGAAGATGCTATGCTGCTGG + Intronic
996976022 5:129435752-129435774 CTCTGATGAAACCTTGATTTTGG - Intergenic
1000122128 5:158207546-158207568 CCCTGTTGTTACCTTGCTTCTGG - Intergenic
1003006459 6:2387117-2387139 CTCTGGTGTTCCTTTGCTTGTGG - Intergenic
1004447136 6:15710692-15710714 CTCTGCTGACACTTTGATTTTGG + Intergenic
1004981429 6:21028964-21028986 ATTTGAAGATACTGTGCTTCGGG + Intronic
1005590381 6:27319048-27319070 CCATGATGATACTTGGCATCTGG + Intergenic
1006339146 6:33436880-33436902 CCCTGCTGATACCTTGCTTTTGG - Intronic
1006843448 6:37046850-37046872 CCCTGATGACACTGTGCTCCTGG + Intergenic
1007482259 6:42157921-42157943 CGCTGATGATTCTTTGTTGCGGG + Intronic
1008321552 6:50120459-50120481 CACTTATGAGACTGTGCTTCAGG + Intergenic
1008440420 6:51526357-51526379 CTCTGATGATATATCGCTTTGGG + Intergenic
1008970386 6:57360571-57360593 CTATTATGACACTTTGCTTAAGG + Intronic
1009159354 6:60262388-60262410 CTATTATGACACTTTGCTTAAGG + Intergenic
1011746109 6:90409367-90409389 CTCTCAGGAGACTTTGCTTCAGG - Intergenic
1012064794 6:94536959-94536981 CTCAGATGAGACTTTGGTTATGG - Intergenic
1012406565 6:98907127-98907149 CTCTGATGATAGTTTTTTGCTGG + Intronic
1012730985 6:102879902-102879924 TTCTGAGGGTACTTTGCTCCTGG - Intergenic
1013764623 6:113560493-113560515 CTCTGCTGATACTTTGATCTTGG - Intergenic
1015905166 6:138108942-138108964 GTCTGAAGCCACTTTGCTTCTGG - Intergenic
1016241442 6:141935992-141936014 CTTTGATGATAATGTGCTTGTGG + Intergenic
1018566777 6:165162934-165162956 CTCAGATGACACTTTGCTGTTGG - Intergenic
1018636577 6:165865112-165865134 CTGTGGTGAGACTTTGCTTGGGG - Intronic
1018740112 6:166722055-166722077 TTCTGATTATATTTTGGTTCTGG - Intronic
1021767094 7:23960725-23960747 CCCTGATGATATTTTTCTTTTGG + Intergenic
1022526512 7:31041431-31041453 CTCTGAGGATACATTTCTTGGGG - Intergenic
1022674448 7:32485340-32485362 CTTTGATTATACTTTTCTTTGGG - Exonic
1024149172 7:46552028-46552050 CTCTGCTGATACTTTCCTAGCGG - Intergenic
1024850737 7:53713744-53713766 CCCTGAGGATACTTTGTTTTGGG + Intergenic
1027638564 7:80705494-80705516 CTCTGATGATGCTCTCCTTTAGG - Intergenic
1031112091 7:117623286-117623308 CTATCATGAGACTTTGCTGCTGG + Intronic
1033943935 7:146690975-146690997 CTCTGATTATGCTGTGATTCTGG + Intronic
1035412428 7:158655753-158655775 CTCTGCTGGGGCTTTGCTTCTGG + Intronic
1036197700 8:6735089-6735111 CTCTGATCCTGCCTTGCTTCTGG + Intronic
1036997894 8:13680328-13680350 CTCTCATGAAACTTTTCCTCAGG - Intergenic
1037485146 8:19339941-19339963 CTCTCATGATATTTTGGTTGGGG + Intronic
1037538076 8:19845918-19845940 CTGTTATGATAGTTTGATTCTGG + Intronic
1039582693 8:38680012-38680034 CTCTGAAGATACATGGCTCCTGG + Intergenic
1044444161 8:92254355-92254377 CTCTGATACTAAATTGCTTCAGG + Intergenic
1045972862 8:108099464-108099486 CTCTCATCATACTCTGCTTGTGG - Intergenic
1046840723 8:118853900-118853922 CTCTGAAGATTCTTTGATTAGGG - Intergenic
1048425371 8:134318684-134318706 CAGGGATGATGCTTTGCTTCTGG - Intergenic
1049085400 8:140474555-140474577 CTCTGAGGATGCTATGCTGCTGG + Intergenic
1050158256 9:2690769-2690791 CTCTGCTGATACCTTGATTCTGG - Intergenic
1050559815 9:6823435-6823457 CTTTGATGATAGTTTTCTGCAGG + Intronic
1056309972 9:85330818-85330840 CTCTCATGATTTTTTGGTTCAGG + Intergenic
1057978925 9:99638398-99638420 CTCACATTATACTTTTCTTCCGG + Intergenic
1059625883 9:116065653-116065675 CTCTGCTGACACTTTGATTTTGG + Intergenic
1061107705 9:128544606-128544628 GTCTGATGCTACTTTCCATCAGG - Intergenic
1061728511 9:132595112-132595134 CTCTGCTGTTACTGTTCTTCAGG - Exonic
1187008544 X:15256182-15256204 TTCTGATAAAACTTTGCTTATGG - Intronic
1187625350 X:21106020-21106042 CACTTATGATACTTTGTTTCCGG - Intergenic
1187673435 X:21691512-21691534 CACTGGTGATACTGTGCTGCAGG + Intergenic
1189793151 X:44622670-44622692 CTCTGCTGATACCTTGATTTTGG - Intergenic
1192256422 X:69464068-69464090 ATCTGATGAAACTATACTTCAGG - Intergenic
1197109213 X:122753331-122753353 CTTTGATTATGCTTTGCCTCAGG - Intergenic