ID: 917770322

View in Genome Browser
Species Human (GRCh38)
Location 1:178269950-178269972
Sequence CCTGATTAGCAGTTCGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917770319_917770322 -7 Left 917770319 1:178269934-178269956 CCAGTAGGGTATTTTTCCTGATT 0: 1
1: 0
2: 1
3: 26
4: 383
Right 917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 61
917770314_917770322 10 Left 917770314 1:178269917-178269939 CCCTTTCCTGTAACACTCCAGTA 0: 1
1: 0
2: 2
3: 39
4: 228
Right 917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 61
917770318_917770322 4 Left 917770318 1:178269923-178269945 CCTGTAACACTCCAGTAGGGTAT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 61
917770315_917770322 9 Left 917770315 1:178269918-178269940 CCTTTCCTGTAACACTCCAGTAG 0: 1
1: 0
2: 1
3: 10
4: 154
Right 917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917770322 Original CRISPR CCTGATTAGCAGTTCGTGGT AGG Intronic
906576079 1:46891668-46891690 CCAGATTGGCAGTTCCTGCTAGG + Intergenic
906595841 1:47075918-47075940 CCAGATTGGCAGTTCCTGCTAGG - Intronic
911680316 1:100707857-100707879 CCTGATTACCACTCTGTGGTTGG + Intergenic
914835472 1:151203128-151203150 CTTGATTTGAAGTTAGTGGTTGG + Intronic
917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG + Intergenic
917770322 1:178269950-178269972 CCTGATTAGCAGTTCGTGGTAGG + Intronic
918828304 1:189355865-189355887 ACTGTTTTGCAGTTGGTGGTGGG + Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1078883069 11:15472245-15472267 TCTGATGACCAGTTTGTGGTTGG - Intergenic
1083710638 11:64546321-64546343 CCGGAGCAGCAGTTCCTGGTGGG - Intergenic
1088545765 11:110957213-110957235 CCTCATTAGCAGCTTGTGCTAGG - Intergenic
1091592507 12:1853124-1853146 CCTCATTAGCTGTTTCTGGTTGG - Intronic
1092455716 12:8640805-8640827 ACTGTTTATCTGTTCGTGGTGGG - Intronic
1101969252 12:109301269-109301291 CCTGACTCTCAGTTCGGGGTAGG + Intronic
1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG + Intronic
1110656597 13:78007407-78007429 TCTGATTAGCAGCTCCTGGACGG - Intergenic
1113399168 13:109975592-109975614 CAGAATTAGCAGTTGGTGGTGGG + Intergenic
1118533202 14:66729986-66730008 CCTGATTATCACTGCCTGGTAGG - Intronic
1119258532 14:73221327-73221349 CCTGAATAGCAATTTGTGATTGG + Exonic
1122179691 14:99946313-99946335 CCTGCTGAGCAGTTCAGGGTCGG + Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1137038677 16:35590048-35590070 GTTAATTGGCAGTTCGTGGTTGG - Intergenic
1148122434 17:45221237-45221259 CCTGTTTAGGAGTTCCTGTTTGG + Intergenic
1149010628 17:51853220-51853242 CCTGATTAGCAGTTTCTGTGGGG - Intronic
1152387858 17:79985838-79985860 CTTGATTGGCAGTTTGTTGTGGG - Intronic
1152824564 17:82456554-82456576 CCTGAGTAGCAGGTTGGGGTGGG - Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
932779715 2:74552562-74552584 CCTGCTGTGCAGTTCGTGCTTGG - Exonic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
943588239 2:189765514-189765536 TTTTATTAGCAGTTTGTGGTGGG - Intergenic
946046044 2:216821851-216821873 CCAGATTAGCAGTCCGTGAGGGG + Intergenic
1174656492 20:52176388-52176410 TCTGATCAGCAGTTCTGGGTGGG + Intronic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
952539229 3:34349731-34349753 TGAGATTAGCAGTTAGTGGTAGG - Intergenic
955316025 3:57939910-57939932 CTTGATTAGGAGTTCCTGCTGGG - Intergenic
964433945 3:156633000-156633022 CCTGATTAGTAGATTGTGGTGGG - Intergenic
969873519 4:10119127-10119149 CCTGATTAACAGTTGTGGGTGGG - Intergenic
989227928 5:39051996-39052018 CCTGAGCAGCAGTATGTGGTAGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
997160485 5:131603913-131603935 CTGGATAAGCTGTTCGTGGTGGG + Intronic
1000979238 5:167798964-167798986 CCTGATTAGGTGTTCATGGACGG - Intronic
1004107924 6:12683711-12683733 CATGATTAACATTTTGTGGTGGG + Intergenic
1004958228 6:20754523-20754545 TCTGATTTGCATTTCCTGGTTGG + Intronic
1004962961 6:20812735-20812757 GCTGAGTAGCATTTCATGGTAGG + Intronic
1007252902 6:40508428-40508450 TCTGATCAGCAGTGGGTGGTGGG + Intronic
1010105972 6:72168465-72168487 CCTGATTATTAGTTTGGGGTGGG + Intronic
1021925740 7:25532025-25532047 CCTGATCTCCAGTTGGTGGTGGG - Intergenic
1022563725 7:31375606-31375628 CCTGCTCAGCACTTCCTGGTAGG + Intergenic
1026956397 7:74378984-74379006 CCTGATTAGCTGTTCAGGGCAGG + Intronic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1047028276 8:120848538-120848560 CCTGATGAGCAGTTTGTTGCTGG - Intergenic
1052684534 9:31738253-31738275 GCTGATTAGCATTTCATGGCAGG - Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1060283148 9:122227314-122227336 CGTGAGCAGCAGTTCGTGGCCGG + Intronic
1060873424 9:127061366-127061388 CATGCTTAGCAGTTTGTGATTGG + Intronic
1203787745 EBV:137146-137168 CCTGGTGAGAAGTTGGTGGTGGG - Intergenic
1189211867 X:39290535-39290557 CCAGATGAGCATTTGGTGGTGGG - Intergenic
1189246054 X:39564463-39564485 CTTGATGAGCAGTGTGTGGTGGG - Intergenic
1193042831 X:77021853-77021875 CCTGATTAGCAATTTCTGATGGG + Intergenic
1194784604 X:98066500-98066522 CCTGATTAAGAGTTTGTTGTTGG + Intergenic
1199226759 X:145385088-145385110 CCTGATTGGCAATTCTTGATTGG - Intergenic