ID: 917772952

View in Genome Browser
Species Human (GRCh38)
Location 1:178300096-178300118
Sequence ACCAGAGGGCGCCACTAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917772945_917772952 2 Left 917772945 1:178300071-178300093 CCGAGGGTCAGTTTCCCGAGTAC 0: 1
1: 0
2: 1
3: 11
4: 107
Right 917772952 1:178300096-178300118 ACCAGAGGGCGCCACTAAACTGG 0: 1
1: 1
2: 1
3: 5
4: 50
917772940_917772952 28 Left 917772940 1:178300045-178300067 CCTGAGGAGAACTGTCAGTGTCC 0: 1
1: 0
2: 1
3: 17
4: 105
Right 917772952 1:178300096-178300118 ACCAGAGGGCGCCACTAAACTGG 0: 1
1: 1
2: 1
3: 5
4: 50
917772944_917772952 6 Left 917772944 1:178300067-178300089 CCTTCCGAGGGTCAGTTTCCCGA 0: 1
1: 0
2: 0
3: 12
4: 140
Right 917772952 1:178300096-178300118 ACCAGAGGGCGCCACTAAACTGG 0: 1
1: 1
2: 1
3: 5
4: 50
917772943_917772952 7 Left 917772943 1:178300066-178300088 CCCTTCCGAGGGTCAGTTTCCCG 0: 1
1: 0
2: 0
3: 10
4: 207
Right 917772952 1:178300096-178300118 ACCAGAGGGCGCCACTAAACTGG 0: 1
1: 1
2: 1
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917772952 Original CRISPR ACCAGAGGGCGCCACTAAAC TGG Exonic