ID: 917773677

View in Genome Browser
Species Human (GRCh38)
Location 1:178309591-178309613
Sequence TGGAAGAATTGGCTTGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917773677 Original CRISPR TGGAAGAATTGGCTTGATTA TGG Intronic
904143403 1:28370725-28370747 TGGAAGAATTTGCTTTATAGAGG + Intronic
906508227 1:46395504-46395526 TGGAAGATGTGGCTTGAAGAGGG + Intronic
906850232 1:49240871-49240893 AGGAAGATTTGGCTGGATAAGGG - Intronic
908713174 1:67040818-67040840 TGGAAGAATTAATTTGCTTAGGG - Intronic
914445220 1:147744644-147744666 TGGAAGTATTAACCTGATTATGG + Intergenic
914816447 1:151066527-151066549 GGGAAGAATGGGCTAGATTTTGG + Intronic
915114775 1:153590306-153590328 TGGAAGAAATAGATTAATTATGG + Intergenic
915729009 1:158039612-158039634 AGGAACAATTGGCATGATTGGGG - Intronic
917773677 1:178309591-178309613 TGGAAGAATTGGCTTGATTATGG + Intronic
917981721 1:180273599-180273621 ACAAAGAATTGACTTGATTAAGG - Intronic
922423501 1:225474543-225474565 TGGAAGAATTAGAATAATTATGG - Intergenic
1063548993 10:7010777-7010799 TGAAGGAAGTGGCTTGATTATGG + Intergenic
1066493382 10:35916964-35916986 AGGAAGCATTGGCTAGATGAAGG + Intergenic
1067298940 10:44992372-44992394 AGGCAGACTTGGCCTGATTAGGG + Intronic
1067501578 10:46809743-46809765 TGCAAACATTGTCTTGATTATGG - Intergenic
1067592998 10:47530166-47530188 TGTAAACATTGTCTTGATTATGG + Intronic
1067640112 10:48038269-48038291 TGTAAACATTGTCTTGATTATGG + Intergenic
1070650215 10:78229898-78229920 TGGCAGATTTGGCTTTATCATGG + Intergenic
1071362470 10:84863177-84863199 TAGAAGAATTGGCATCATCAGGG + Intergenic
1072469616 10:95700367-95700389 TGGAAGAATTAAATTGGTTAAGG + Intergenic
1072903923 10:99433251-99433273 TATCAGCATTGGCTTGATTATGG - Intergenic
1076168213 10:128299281-128299303 TGGAAGAAATGACTTTATGATGG + Intergenic
1079309631 11:19353359-19353381 TGGATGAAATGGCTAGTTTAGGG + Intronic
1079537738 11:21535259-21535281 TGAAAGAATTGGATTGGCTAAGG - Intronic
1081392486 11:42545268-42545290 TGGCAGAATGGGCTTGGTTCTGG - Intergenic
1083411246 11:62493873-62493895 ATGAAGAATTTGCTTCATTATGG - Intronic
1088661866 11:112055179-112055201 TGGCAGAAATGGCTTGCTTAAGG + Intronic
1088664998 11:112085775-112085797 TGGAAGAATTACCTTGTCTAGGG - Intronic
1091199216 11:133760146-133760168 TGGAAAAATGGACTTGCTTAAGG - Intergenic
1093768694 12:22995611-22995633 GTGAAGAATTGACTTGATGAAGG + Intergenic
1096024116 12:48346568-48346590 TGGAAGGATTGGGTAGATGAGGG - Intronic
1097457435 12:59817129-59817151 TTGAAGAAGTGGTTTGATTTGGG + Intergenic
1097557379 12:61156035-61156057 TGGGAGAATGGGATAGATTAGGG - Intergenic
1098209801 12:68151710-68151732 TGGAAGAATGGCCTGGAGTAGGG - Intergenic
1098500144 12:71182850-71182872 TGGAAATATGAGCTTGATTACGG + Intronic
1099812262 12:87598532-87598554 TGAAACTATTGGCTTCATTATGG + Intergenic
1101479390 12:105083005-105083027 GGGAAGAACTGGCGTGATCAGGG - Intronic
1109401942 13:61844177-61844199 TGAAAGATTTGTCTTAATTAGGG - Intergenic
1109621992 13:64922336-64922358 TGGAAGAATTGGTTTGACTTTGG + Intergenic
1110509308 13:76330096-76330118 GGTAAGAATGGGCTTGAATATGG - Intergenic
1110527110 13:76550961-76550983 TGTGATAATTAGCTTGATTATGG + Intergenic
1110913605 13:80994254-80994276 TGGTAGAAATGGGTTGATGAGGG + Intergenic
1110972390 13:81781501-81781523 GGTAAGTATTGGCTTGGTTATGG + Intergenic
1111482875 13:88855117-88855139 TGGAAGAATGGCCCTGATTCAGG + Intergenic
1112860185 13:103820599-103820621 TGGGAGAATTGGCTTGAGCCTGG - Intergenic
1113265552 13:108613074-108613096 TGGAAAGATGGGATTGATTATGG + Intronic
1114816427 14:25964357-25964379 TGGATGATTTGACTTTATTAAGG - Intergenic
1116244032 14:42385144-42385166 AGGAAGATTTGGAGTGATTAAGG - Intergenic
1116258160 14:42584903-42584925 TGGAATCATTGGCTTGATTTGGG - Intergenic
1116612701 14:47097389-47097411 TGGAATAATAAGCATGATTAAGG + Intronic
1117653898 14:57934682-57934704 TGGAGGACCTGGCTTCATTAGGG - Intronic
1120702514 14:87713466-87713488 TGGTAGAATGGGCTAGATTGTGG - Intergenic
1121265449 14:92599417-92599439 TGGCAGAAATGGCATGATGAAGG + Intronic
1122676728 14:103421391-103421413 TGAAAGAAGAGGCTTAATTATGG + Intronic
1125781654 15:42274240-42274262 TGGCAAATTTGTCTTGATTATGG - Exonic
1125980667 15:43997694-43997716 TGCAAGCATTGTCTAGATTATGG - Intronic
1126288626 15:47045453-47045475 TTAAAGAATTAGTTTGATTATGG + Intergenic
1129639976 15:77365809-77365831 TTGAAGAATTGAGTTGATGAAGG - Intronic
1131859602 15:96638377-96638399 TGAAAGACTTGGCTTATTTATGG - Intergenic
1132394277 15:101460383-101460405 AGGAAGATTTGGCTTGATGGAGG - Intronic
1135458579 16:22620742-22620764 TGGAAATATTGGCTTCATTCTGG - Intergenic
1140929163 16:79611052-79611074 TGGAAGAATGGGCATGATTTGGG - Intergenic
1146942570 17:36854206-36854228 TGGATGTGTTAGCTTGATTATGG + Intergenic
1147700436 17:42390619-42390641 TGGAAGAATAGGATAGAATAAGG - Intergenic
1148960833 17:51391412-51391434 TGTAAGAATTGGCTAGCTCAGGG + Intergenic
1149182974 17:53962715-53962737 TAGAAGACTTGGTTTTATTAAGG + Intergenic
1153590275 18:6666893-6666915 TGGAAGAATTGCCTTCAGTGTGG - Intergenic
1153940543 18:9972963-9972985 TGGAGGAAAGGGCTTGAATAAGG + Intergenic
1154963179 18:21330063-21330085 TATAAGAACTGGCTTAATTATGG - Intronic
1156296750 18:35799157-35799179 TTCTAGAATTGGCTTGATTCTGG - Intergenic
1156768700 18:40692353-40692375 TGGAAGATTTGGCATGATATTGG + Intergenic
1157960011 18:52142957-52142979 TGTAAGAAATTGCTTGATAAAGG - Intergenic
1158982376 18:62776095-62776117 TTAAGGAATTGGCTTGCTTATGG + Intronic
1159064672 18:63556831-63556853 TGGGAGAAGTGCCTGGATTATGG - Intronic
1159222988 18:65489500-65489522 AGGTAAAATTGCCTTGATTATGG + Intergenic
1162238881 19:9331714-9331736 TGCAATTATTAGCTTGATTATGG + Intronic
1162586455 19:11562072-11562094 GGAAATAATTGTCTTGATTATGG - Intronic
1165537192 19:36458772-36458794 TACATTAATTGGCTTGATTATGG + Intronic
1166590533 19:43993835-43993857 TGGAAGAATTTACTTAATTCAGG + Intronic
1168585127 19:57585534-57585556 TAGAAGAAGTGGCTGGATTCTGG + Intronic
931294872 2:60912432-60912454 TGGTAAAATTGGTTTTATTATGG + Intronic
931744020 2:65275872-65275894 TGGAAGTATTGAATTGTTTATGG + Intergenic
931782312 2:65589373-65589395 GGGAAGAACTGGCTAGATGATGG + Intergenic
935887018 2:107632803-107632825 TGGTATAATTTGCTTGAATATGG + Intergenic
936935898 2:117837867-117837889 TTCAAGAATTGTCTTCATTAGGG - Intergenic
937187572 2:120059185-120059207 TGGAAGAATAGTCTTAATAATGG + Intronic
939821496 2:146962059-146962081 TGGATGAGTTGGTTGGATTAAGG - Intergenic
940474040 2:154137746-154137768 TGGAAGCATTGTGTTGATTATGG + Intronic
942373302 2:175309634-175309656 GGGAGGAAATGGCTAGATTAGGG + Intergenic
943056712 2:182990929-182990951 TTGAATAATTGGCTTGTTTTAGG - Intronic
943623202 2:190172469-190172491 TAGAATATTTGGCTTGAATAGGG - Intronic
945230247 2:207580892-207580914 TGAAAGCATTTGCTTGATTTTGG + Intronic
945692686 2:213059413-213059435 TGGAAGAATTACTTAGATTATGG - Intronic
946986568 2:225280417-225280439 TGAAGGAATTGGCTTCATTCAGG - Intergenic
1171031395 20:21680218-21680240 TAGAAGAATAGGCTGGTTTATGG + Intergenic
1172983239 20:38961281-38961303 TGAAAGAAGTGGCATCATTATGG - Intergenic
1173049173 20:39542393-39542415 TGGAAGAATTCACTTCATTATGG - Intergenic
1173132769 20:40410159-40410181 TGGGAGAATTGTCTTGGGTATGG - Intergenic
1173431625 20:42992621-42992643 TGGAAGATTAGACTTGACTAGGG + Intronic
1174464981 20:50710403-50710425 TGGATGAAGTGGCTCGAATATGG + Intergenic
1176938205 21:14892204-14892226 TAGAAGAGTTGGCAGGATTAAGG + Intergenic
1177505120 21:22009846-22009868 TGGAAGCATTGGCTTTAGTAAGG + Intergenic
1182917230 22:34045754-34045776 TGGAAACACTAGCTTGATTAGGG - Intergenic
951593204 3:24288975-24288997 TGAAAGAAGTGACTTGCTTAAGG + Intronic
951675166 3:25231101-25231123 TAGAAGTATTTGCTTGTTTAAGG - Intronic
954820447 3:53322104-53322126 TGGAATAATGGGCTTAATTCAGG - Intronic
955145044 3:56309101-56309123 TGGAAGAGTTGGCCTGCTGAGGG + Intronic
955331286 3:58049724-58049746 TGGAAAAATTGGCTTGCTCTCGG + Intronic
955985601 3:64570937-64570959 TGGTAAAATTTGCTTGACTAGGG + Intronic
958746047 3:98136164-98136186 TGAAAGAAATGGCCTGATTATGG - Intergenic
958748953 3:98172200-98172222 TGAAAGAAATGGGGTGATTATGG - Intronic
958825982 3:99031659-99031681 TGGAAGAATTGATTTTGTTAAGG + Intergenic
960641888 3:119832990-119833012 TGTAAGAGTTGGCTAGATAATGG + Intronic
960901737 3:122560974-122560996 TGGAAGAAATGGAATGCTTAGGG - Intronic
962192437 3:133325849-133325871 TTGAAGAATTGGGTTTTTTAAGG + Intronic
962752591 3:138444778-138444800 TGGAAGAATTCCCTTTATAAAGG + Intronic
963661887 3:148136886-148136908 GGGAAAACTTGGATTGATTATGG - Intergenic
964526809 3:157623339-157623361 TGGAATAATTGAATTGATGAAGG + Intronic
966042774 3:175511742-175511764 AGGTAGAATTGGCATGTTTATGG - Intronic
969120374 4:4904311-4904333 TGGAAAAATTGGATGGATCATGG - Intergenic
971826855 4:31634658-31634680 TGGGAGAATTGGCAAGAGTAGGG - Intergenic
971910079 4:32784528-32784550 TTGAAGAATTGGCTAGACTGAGG - Intergenic
972222142 4:36968058-36968080 TGGAAGAGTGGGCTATATTAGGG + Intergenic
972814714 4:42631406-42631428 TGGGAGAGTTGAATTGATTATGG - Intronic
972971257 4:44579083-44579105 TGGAAGAATAGTCTAGATTTAGG - Intergenic
973319898 4:48799407-48799429 TGGAAGAATTTGTTTGGTTGGGG + Intergenic
975234535 4:71976811-71976833 TGGAAGAATTTACTGGATAAGGG + Intergenic
978615605 4:110592156-110592178 TGGAAGAATGGGCTTTTATATGG + Intergenic
979354785 4:119690659-119690681 TGGAAGAACTGGCTGGATGGTGG + Intergenic
979404068 4:120287316-120287338 TGGAAGAAATGGGATGTTTAAGG + Intergenic
979611839 4:122697690-122697712 GGGAAGAATGGGCTGGATTTGGG - Intergenic
980713785 4:136605868-136605890 AGGAAGAAATGGCATCATTAGGG - Intergenic
980890498 4:138809792-138809814 TAGAAGAACTGGCTTGGTTGAGG - Intergenic
981434735 4:144707239-144707261 TGGAAGAAATGGATGGGTTAAGG + Exonic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
985250372 4:188018241-188018263 TGGATGCAGTGGCATGATTATGG + Intergenic
985348322 4:189031337-189031359 TAGATGGATTGGATTGATTATGG - Intergenic
988697909 5:33642593-33642615 TGGAAGGATTGCCTTGAAGAGGG - Intronic
989430918 5:41354459-41354481 TTGAACAATTGGCTTGTTTTAGG - Intronic
991011161 5:61884305-61884327 TGGCAGAATTTGCTTGACTGTGG - Intergenic
991487241 5:67150154-67150176 TGGAAAACTGGGCTTAATTAAGG + Intronic
992986170 5:82232652-82232674 AGAAAGAAGGGGCTTGATTAGGG - Intronic
994723382 5:103406305-103406327 GGAAAGAATTAGCTTGAATATGG - Intergenic
994787113 5:104179661-104179683 TGGAGGAAGTGGGTTGATTTGGG - Intergenic
994908534 5:105871749-105871771 TGGAAGAAATGTCTTTAATATGG - Intergenic
997663487 5:135607834-135607856 AGGCAGAATTGGCTTATTTATGG + Intergenic
998151445 5:139759720-139759742 CGGAAGAATTGGAGTGATTAGGG - Intergenic
1001648901 5:173301545-173301567 TAAAAGGATTGGCTTGATTTTGG + Intergenic
1004246043 6:13977058-13977080 TTGAAGAATGGCTTTGATTAAGG - Exonic
1010850085 6:80764228-80764250 TGGAAGAATGGTCTGGCTTAGGG + Intergenic
1012922903 6:105237226-105237248 TTGTAGAAGTGGCTTGATAATGG - Intergenic
1016012791 6:139156293-139156315 TGGAAGCATTGGCTTGAGCCTGG - Intronic
1019759811 7:2802488-2802510 TAAAAGATTTGGTTTGATTAGGG - Intronic
1020494593 7:8833469-8833491 TGGGATAAGTGGCTTGATTGTGG - Intergenic
1022227541 7:28379108-28379130 TGGAACAATTGTCTTGATAAAGG + Intronic
1023094557 7:36647236-36647258 TGGAAGAACTGGCTTAACTTGGG + Intronic
1023166506 7:37348621-37348643 TGGAAGAGTGGGCTTGTTCACGG - Intronic
1028116284 7:87001591-87001613 TGGAAGACTTTGCTTTATTAGGG - Intronic
1028179093 7:87696685-87696707 AGGATGACTTGGCTTGATTCTGG - Intronic
1028263562 7:88694259-88694281 TGGGACAAGTGGCTTGAATAGGG + Intergenic
1030037923 7:105423883-105423905 TGGTAGAATTTGCTTTATTGTGG + Intergenic
1030403942 7:109086844-109086866 TAGAAGAAATGGCTTCCTTATGG - Intergenic
1030814493 7:114018465-114018487 TGGAAAAATTATCTTTATTAGGG + Intronic
1031130930 7:117832481-117832503 TGGAAGAACTTGCTTGGTGAGGG - Intronic
1031411709 7:121447584-121447606 TGGAAGAATTGGCCTGGTGAAGG - Intergenic
1034480303 7:151314731-151314753 TGGAGGATCTGGCTTGATGAGGG + Intergenic
1034927191 7:155131630-155131652 CGGCAGAATTGGCCTGATTTGGG - Intergenic
1036821498 8:11943261-11943283 TGGAAGAGTTGGACTGATTCAGG - Intergenic
1038925457 8:32134496-32134518 TGTAAGAATTGGCAGGAATAGGG - Intronic
1039759197 8:40556403-40556425 TTGAAAAATTGGATTGATGATGG - Intronic
1039867089 8:41514668-41514690 TGGAATAAATGGCTTTATGATGG + Intergenic
1044301926 8:90594474-90594496 TGAATGAATTGGCATCATTATGG + Intergenic
1045227416 8:100262813-100262835 AGTAAGAAGTGGCTGGATTATGG + Intronic
1046687775 8:117245949-117245971 TAGCACAATTGGCTTGATCAGGG + Intergenic
1050169398 9:2799532-2799554 TGGCAGAAATAGTTTGATTATGG + Intronic
1050394319 9:5178790-5178812 TGGAAGAATTGGCTAGCTGTAGG + Intronic
1050708813 9:8435603-8435625 TGCATTAATTGGCTTCATTAAGG + Intronic
1050850249 9:10276209-10276231 TGAAAGCAATGGCTGGATTAAGG - Intronic
1051263404 9:15288060-15288082 TGGTAGAAATGACTTTATTAAGG - Intronic
1051972798 9:22911429-22911451 TGGAGGCATTGGCATCATTAGGG + Intergenic
1053176906 9:35932410-35932432 TGGAAGTACTGGCATGATCATGG - Intergenic
1056258575 9:84825137-84825159 AGGAAGACTTGGCTTGATTTTGG - Intronic
1057038198 9:91827177-91827199 TAGAAGAATTGGGTTCCTTATGG - Intronic
1058017605 9:100053381-100053403 TGAAATGTTTGGCTTGATTAAGG - Intronic
1058227945 9:102389955-102389977 TGGAAAAACTGGCATGGTTAAGG - Intergenic
1059510920 9:114845915-114845937 TGGAAAAACAGCCTTGATTAAGG + Intergenic
1186528954 X:10276195-10276217 TGGAAGCATTGGATTTTTTAAGG - Intergenic
1186539597 X:10386957-10386979 AGGCAGAATTGGCTTGTTAATGG + Intergenic
1186952196 X:14639063-14639085 TGTAATAATTGGCTTGATCAAGG - Intronic
1187373422 X:18729077-18729099 TGGAAGTATTGTCTTGTTTGTGG - Intronic
1189333777 X:40158045-40158067 TGGAAGAAATGGCTTGGGTGTGG + Intronic
1189947800 X:46196981-46197003 TGGAGGGAATGGCATGATTATGG + Intergenic
1191803670 X:65109347-65109369 TGGAGGAAATGCGTTGATTAGGG - Intergenic
1194266535 X:91760422-91760444 TGGAAGAATTAGCTTAATTAAGG + Intergenic
1195513132 X:105740502-105740524 TGGCTGAATTGGCTTGATTTGGG - Intronic
1199313855 X:146353789-146353811 AGAAAGAACTGGCTTGAGTAAGG + Intergenic