ID: 917777000

View in Genome Browser
Species Human (GRCh38)
Location 1:178348654-178348676
Sequence CAAACTGGAGCGCTTATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917777000_917777003 28 Left 917777000 1:178348654-178348676 CCTATTATAAGCGCTCCAGTTTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 917777003 1:178348705-178348727 CTAGGCAACTTCCAAGTTGATGG 0: 1
1: 0
2: 0
3: 4
4: 95
917777000_917777002 10 Left 917777000 1:178348654-178348676 CCTATTATAAGCGCTCCAGTTTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 917777002 1:178348687-178348709 AAACAAAAACAAAAAACTCTAGG 0: 1
1: 21
2: 175
3: 1715
4: 11422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917777000 Original CRISPR CAAACTGGAGCGCTTATAAT AGG (reversed) Intronic
906029247 1:42704578-42704600 CAAATTTGAGTGTTTATAATTGG + Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909306889 1:74092806-74092828 CAAATTGAAGCGGTTACAATAGG + Intronic
914688202 1:150001424-150001446 CAAACAGCAGCGCTTAGAACAGG + Intronic
917777000 1:178348654-178348676 CAAACTGGAGCGCTTATAATAGG - Intronic
919118974 1:193315328-193315350 CCAACTGGAGCACCTATAAGAGG + Intergenic
919401789 1:197127666-197127688 CAAACTGGAATGCTCAAAATTGG - Intronic
920827417 1:209434929-209434951 CAAACTGGTGCCCTGATTATAGG - Intergenic
1071311894 10:84350848-84350870 AAAGCTGAAGCGCTTATAAATGG - Intronic
1073120350 10:101118729-101118751 CCAACTGAAGAGCTTAAAATGGG - Intronic
1081469019 11:43352240-43352262 AAAACTGGAGAGCATATAGTAGG - Intergenic
1081494102 11:43589343-43589365 CAAACTGCAGGGCTGATTATAGG + Intronic
1094605250 12:31943907-31943929 CAGGCTGGGGAGCTTATAATGGG + Intergenic
1104346388 12:128003464-128003486 CAAACTGCTGGGATTATAATAGG - Intergenic
1106814945 13:33397322-33397344 GAAACTGGAGTTTTTATAATGGG - Intergenic
1111167926 13:84486957-84486979 CTAATTGGAGCCCTTAAAATTGG - Intergenic
1111655490 13:91146662-91146684 CAAACTGGAGAGCTAAAACTTGG + Intergenic
1114211462 14:20619076-20619098 CACACAGGAGTGTTTATAATGGG - Intergenic
1117356703 14:54930950-54930972 GAAACTGGATCGCTTATATATGG - Intergenic
1127050913 15:55083004-55083026 GAAACTGGATCACTTATTATTGG - Intergenic
1127327725 15:57911815-57911837 CAAACAGAAGTGCTTATAAAAGG + Intergenic
1134800687 16:17081791-17081813 CAACCTGGAGCACTTATAAGGGG + Intergenic
1140640961 16:76972351-76972373 CAAAGTGGTGCTCTAATAATTGG + Intergenic
1151522374 17:74639591-74639613 GAAACTGGAGCCCTCATAAATGG - Intergenic
1156153842 18:34277731-34277753 CACACTGGAGAGCATTTAATTGG + Intergenic
1157377748 18:47181973-47181995 TAAAATGGAGTGCTTTTAATAGG - Intergenic
1159534293 18:69695486-69695508 CAAAATGGAGTGGTTAAAATTGG - Intronic
925722710 2:6844108-6844130 CAAACTGGGGCACTTAAAAGGGG - Intronic
931743667 2:65272795-65272817 CAAACTGAGACACTTATAATAGG - Intergenic
934098861 2:88632660-88632682 AGAACTGGAGCACTTATTATTGG + Intergenic
937589837 2:123599651-123599673 CAAACTGGAGCAATTATAGTTGG + Intergenic
938908665 2:135864307-135864329 CAAAATGGAGTGTTTATGATTGG - Intronic
939326495 2:140696713-140696735 CAATCTGGATCCCTCATAATAGG - Intronic
939402295 2:141710023-141710045 GAGAGTGGAGCCCTTATAATGGG - Intronic
941086507 2:161124335-161124357 CAGACTGGTGTGCTTATAAGAGG + Intergenic
941604367 2:167578908-167578930 CAGAATGGAGCGTGTATAATAGG + Intergenic
941926160 2:170897493-170897515 CAATCTGGAGAGCCTAAAATAGG + Intergenic
1178808372 21:35858623-35858645 CAGAATGGAGTGCTTATATTAGG - Intronic
950348157 3:12318684-12318706 CAGACTGTAGAGCTCATAATTGG - Intronic
954253676 3:49388300-49388322 CAAAGTGGTGGGATTATAATAGG + Intronic
959589020 3:108055388-108055410 CAAATTTGAGCGTTTATATTAGG - Intronic
965094299 3:164203946-164203968 CAAGGTGGGGCCCTTATAATGGG - Intergenic
965708950 3:171537209-171537231 AAAACTGGTGCCCTTATAAGAGG - Intergenic
968003137 3:195221429-195221451 CAAACAGTAGCGCTTAGCATAGG + Intronic
971016822 4:22497521-22497543 CTCACTGGAGCTCTTTTAATAGG - Intronic
974348724 4:60716643-60716665 CTTACTGGAGCACTTATTATGGG - Intergenic
978885062 4:113759647-113759669 CAAACAAGAGCGGTCATAATTGG - Intronic
981591948 4:146374051-146374073 CAAACTGGAGTGCTATTCATTGG + Intronic
981810526 4:148769052-148769074 AAAACTGGAATGCTTATGATGGG + Intergenic
988215132 5:28262197-28262219 CAAAGTGGAGCCCTCATAAATGG - Intergenic
994184852 5:96806190-96806212 CAAACTGGAACACTTACTATTGG - Intronic
1006453300 6:34117745-34117767 CTAATTGGAGCGGTTATCATGGG - Intronic
1009644847 6:66386868-66386890 CAAAATGCAGCATTTATAATAGG - Intergenic
1016384033 6:143513705-143513727 CAAACTGGAGCTATTGCAATTGG - Intergenic
1021625318 7:22587212-22587234 TAAACTGGAGGGCTGGTAATTGG - Intronic
1029912983 7:104174616-104174638 CACACTGTATCGCTAATAATTGG + Intronic
1030841294 7:114357608-114357630 GAAACTGGAGAGCTTATTTTTGG + Intronic
1034215234 7:149400531-149400553 CTTACTGGAGTGCTAATAATTGG + Intergenic
1039041547 8:33413267-33413289 GACACTGGAGCCCTTATGATAGG + Intronic
1047857259 8:128924997-128925019 CAAGGTGGAGCCCTTATAAAGGG + Intergenic
1198515776 X:137405632-137405654 CAAACTGGAGCGATTTGAAGGGG - Intergenic
1201557396 Y:15277745-15277767 CAAAATAGAGCACTTATAAATGG + Intergenic