ID: 917779787

View in Genome Browser
Species Human (GRCh38)
Location 1:178381305-178381327
Sequence CTTCTCATGCAGATTATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917779787_917779793 8 Left 917779787 1:178381305-178381327 CCTGCCATAATCTGCATGAGAAG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 917779793 1:178381336-178381358 CCCTAGATTAGGATGGTGGATGG 0: 1
1: 0
2: 2
3: 8
4: 108
917779787_917779795 14 Left 917779787 1:178381305-178381327 CCTGCCATAATCTGCATGAGAAG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 917779795 1:178381342-178381364 ATTAGGATGGTGGATGGTAGTGG 0: 1
1: 0
2: 2
3: 35
4: 382
917779787_917779789 -3 Left 917779787 1:178381305-178381327 CCTGCCATAATCTGCATGAGAAG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 917779789 1:178381325-178381347 AAGATAAAAAGCCCTAGATTAGG 0: 1
1: 0
2: 3
3: 23
4: 301
917779787_917779791 4 Left 917779787 1:178381305-178381327 CCTGCCATAATCTGCATGAGAAG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 917779791 1:178381332-178381354 AAAGCCCTAGATTAGGATGGTGG 0: 1
1: 0
2: 0
3: 17
4: 150
917779787_917779790 1 Left 917779787 1:178381305-178381327 CCTGCCATAATCTGCATGAGAAG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 917779790 1:178381329-178381351 TAAAAAGCCCTAGATTAGGATGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917779787 Original CRISPR CTTCTCATGCAGATTATGGC AGG (reversed) Intronic
905543171 1:38776433-38776455 CTTCTCTTGGACATTATGGCTGG - Intergenic
911269517 1:95783352-95783374 CTTCTCAGGGAGACTTTGGCAGG - Intergenic
917294176 1:173501975-173501997 CTTCTCTTGCTGTTTATGGCTGG + Intronic
917779787 1:178381305-178381327 CTTCTCATGCAGATTATGGCAGG - Intronic
918887204 1:190210574-190210596 CTTATTATGAAGACTATGGCAGG + Intronic
923628438 1:235633382-235633404 CTTCTCATGTACCATATGGCGGG + Intronic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1069823989 10:71244216-71244238 AGTCTCATGCTGATTATGCCTGG - Intronic
1073939398 10:108677749-108677771 CATCTTATGTAGATGATGGCAGG - Intergenic
1077343954 11:2037915-2037937 TTTCCCATCCAGATTCTGGCAGG - Intergenic
1077578604 11:3402823-3402845 CTTCTCATTGAGACTGTGGCGGG - Intergenic
1078469216 11:11573689-11573711 CATCTCATGAAGCTTTTGGCTGG - Intronic
1079237311 11:18699678-18699700 CTTCCCATGGAAATTAAGGCTGG - Intronic
1083536198 11:63468845-63468867 GTTCTCCTGCAGTTTCTGGCTGG + Intronic
1085275445 11:75295733-75295755 TTTCTCATCCAGATCATTGCTGG - Intronic
1087591571 11:100195873-100195895 CTTCTCATGTAAATTATGTCTGG + Intronic
1088233700 11:107700167-107700189 CTTATCATGCAGACCCTGGCTGG + Intergenic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1202826940 11_KI270721v1_random:93104-93126 TTTCCCATCCAGATTCTGGCAGG - Intergenic
1098727579 12:73987925-73987947 CATCTCACTCACATTATGGCAGG - Intergenic
1104022071 12:124999138-124999160 CCTCTCAGGCAGAATATAGCTGG + Intronic
1107097068 13:36548431-36548453 CCTATCAGGCAGACTATGGCAGG + Intergenic
1109143518 13:58747259-58747281 CTTCTCAATCAGATTATAGCAGG + Intergenic
1110279385 13:73675225-73675247 CTTCTCAGGCAGAATATTCCAGG + Intergenic
1116655431 14:47647143-47647165 CGTGTCATGCAGATTAAGTCAGG + Intronic
1118860463 14:69658945-69658967 CTCCTGATGATGATTATGGCTGG - Intronic
1126855906 15:52839131-52839153 ATTCTCAGGCAGATTCTGTCTGG + Intergenic
1135627726 16:24010721-24010743 CTTCTCCTGCAGGTTTTGGGAGG + Intronic
1143301149 17:5911577-5911599 CTTCTCCTGCTGATCACGGCAGG + Intronic
1143666594 17:8365677-8365699 CTTCACATGCAGAATCTCGCTGG + Intergenic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1147163735 17:38582348-38582370 TCTCCCAGGCAGATTATGGCAGG + Intronic
1147930715 17:43978851-43978873 CTTCTGATGCAGAGTATGGAGGG - Intronic
1151081296 17:71332698-71332720 CTTCTCTTTCAGTTTATGGTAGG + Intergenic
1151922677 17:77169413-77169435 CTTACCATGCAGCTTATGCCCGG + Intronic
1164956061 19:32386071-32386093 CTAATCATCCAGAATATGGCGGG + Exonic
1165968109 19:39601870-39601892 TTTCTCCTGCAGATTCTGGGAGG - Intergenic
926223745 2:10953130-10953152 ATTATCATGTAGATGATGGCAGG - Intergenic
926423674 2:12722083-12722105 CATCTCATCCAGATTATTGGTGG + Intronic
932811172 2:74827459-74827481 CTTCTCATGCGGATTGTTGGAGG + Intergenic
933804439 2:85987897-85987919 CTTCTCAAGTAGATTGAGGCTGG - Intergenic
933990868 2:87633060-87633082 CTTCTCATGCAGCTGATCGTTGG + Intergenic
936302974 2:111317763-111317785 CTTCTCATGCAGCTGATCGTTGG - Intergenic
937173732 2:119904183-119904205 TTTCTCATTCAGATTATGAATGG - Intronic
939146622 2:138423466-138423488 TTTCTCATTCACATTACGGCTGG - Intergenic
940479108 2:154205671-154205693 CATCTTATGCAGATGCTGGCAGG + Intronic
944219801 2:197291576-197291598 TTTCTCATGCAGAATTTGGCTGG - Intronic
1169468887 20:5865865-5865887 CATCTCATGCATGTTATGACTGG + Intergenic
1170800146 20:19583924-19583946 CTTCTCCTGCAGACTATTGTGGG + Intronic
1173150913 20:40565901-40565923 CTCCTGATGCAGATTATCCCTGG - Intergenic
1178764275 21:35434537-35434559 GTGCTCATGCAGATTAAGGGTGG + Intronic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
949414044 3:3798087-3798109 CTTTTCATGCAGATTATCCATGG - Intronic
950528999 3:13541694-13541716 CGTCCCATGCAGCTGATGGCTGG - Intergenic
954268749 3:49490995-49491017 CTACTCAGGGAGATTGTGGCAGG - Intronic
955288751 3:57670772-57670794 CTTCTCTTTCAGATCATAGCTGG - Intronic
957051612 3:75416136-75416158 CTTCTCATTGAGACCATGGCGGG - Intergenic
959886242 3:111504562-111504584 CTTCTCATGCCAATTTTGGGAGG - Intronic
960977842 3:123193726-123193748 CTTATCAGGCAGACTGTGGCAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964979299 3:162659737-162659759 CTTCACATGCAAATAATGGATGG - Intergenic
965664966 3:171083462-171083484 CATCTCATACAGATTAAGGAAGG - Intronic
969595150 4:8144529-8144551 CATTTAATGCAGATTATGGAGGG + Intronic
972823953 4:42734825-42734847 CTACTGATGCATTTTATGGCAGG - Intergenic
976118893 4:81758711-81758733 CTGCTCATGCAAATTATGTGTGG - Intronic
982834254 4:160103750-160103772 GTTCTAAGGCAGATTATGGAGGG + Intergenic
983278669 4:165652261-165652283 TTTCTCATACTGATTATGTCAGG - Intergenic
988028676 5:25733519-25733541 CTTCTCATGTACATTGTGTCTGG + Intergenic
990201088 5:53375670-53375692 TTTCTCATGCAGATTACTTCAGG - Intergenic
991051703 5:62279568-62279590 ATGCTCATGCATATTATGGAAGG + Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
996578980 5:125008810-125008832 CTTATCATGAAAAATATGGCTGG - Intergenic
1002535717 5:179874358-179874380 CATCTCTTGCAGATTCTGTCTGG - Intronic
1002839101 6:890641-890663 CTTCTCATGCTGCTGGTGGCGGG + Intergenic
1003505762 6:6739066-6739088 CTACTCAAGCAGCCTATGGCAGG + Intergenic
1005010059 6:21327530-21327552 CTTCTCATCCACACTGTGGCTGG - Intergenic
1011665627 6:89630128-89630150 CTTCTCAGGTAGATTGAGGCGGG + Intronic
1016764367 6:147775356-147775378 ATACTCATGTAGATTATTGCAGG - Intergenic
1020318676 7:6924879-6924901 CTTCTCATTGAGACTGTGGCAGG - Intergenic
1020591292 7:10141009-10141031 CTTCTCATGGAGATGTTGCCTGG + Intergenic
1021885854 7:25138042-25138064 CTTCTCATGCCAATTTTGGGAGG + Intronic
1022881919 7:34596642-34596664 CTTCTCAGGCACATTGTGACTGG + Intergenic
1028335891 7:89654266-89654288 CATCTCATGTACATTATGACTGG - Intergenic
1029881257 7:103812567-103812589 CTTCTATTGCAGTTTATAGCTGG + Intronic
1030626779 7:111853597-111853619 GTTCTCATGCAGACAATGTCAGG + Intronic
1030707282 7:112706784-112706806 CTTCTCATGAAGAATAATGCTGG - Intergenic
1033200966 7:139369792-139369814 CTTGTCATGGGGATTATGGTGGG + Intronic
1035820344 8:2584551-2584573 TTTCCTATGGAGATTATGGCAGG + Intergenic
1043438676 8:80258003-80258025 CTTCACTTGCAAATTCTGGCCGG + Intergenic
1047020544 8:120770883-120770905 TTTCTTATGCAGTTTATGTCTGG + Intronic
1047957835 8:129988751-129988773 CTTGTTATGTAAATTATGGCGGG + Intronic
1050194235 9:3063702-3063724 CTGCTCAGGCAGATGCTGGCTGG + Intergenic
1051502353 9:17791785-17791807 CCTCTCACACAGGTTATGGCTGG - Intronic
1052168704 9:25366355-25366377 GTTCCAATGCAGATTATTGCTGG - Intergenic
1052392213 9:27893401-27893423 ATTCTCATGCAGTTTTTGACAGG + Intergenic
1057320103 9:94004913-94004935 CTTCTAATGTAGATTATGCCAGG + Intergenic
1058665514 9:107311347-107311369 CTTCTCATGTAAATTATTTCAGG + Intronic
1059122164 9:111650790-111650812 CTTCTTAAGCAGGTTTTGGCTGG - Intronic
1191094485 X:56659863-56659885 CTTCTCATGTAGAATCTTGCAGG + Intergenic
1192173078 X:68868672-68868694 CTGCTCATCCAGATTATGGGAGG - Intergenic
1195421795 X:104683828-104683850 CTTCTCATGGAGATTGAGGTGGG + Intronic
1196360387 X:114847991-114848013 GTTCTCTTTCAGATTATGTCTGG + Exonic
1197768459 X:130074056-130074078 CTTCTCATCCAGGATATCGCTGG + Exonic
1202604146 Y:26624900-26624922 CTTCTGATGCAGATGAAGTCTGG - Intergenic