ID: 917783422

View in Genome Browser
Species Human (GRCh38)
Location 1:178425318-178425340
Sequence TCACCCATTAAGTTAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917783422 Original CRISPR TCACCCATTAAGTTAAAAAC TGG (reversed) Intronic
901662096 1:10804870-10804892 TCACCCATTAAGACCAAAACAGG + Intergenic
902893681 1:19463821-19463843 TCACCCTCTATGTTAAAAAGAGG + Intronic
903840759 1:26237975-26237997 TCACCCAGTATGTGAAGAACTGG + Intronic
908654747 1:66376146-66376168 TCAGCCAGTAAGATAAAACCAGG - Intergenic
911235766 1:95410686-95410708 TCTCCCATTTGTTTAAAAACAGG - Intergenic
917783422 1:178425318-178425340 TCACCCATTAAGTTAAAAACTGG - Intronic
917917218 1:179714534-179714556 TCACCAATCAAATTCAAAACAGG - Intergenic
919363931 1:196632728-196632750 TCAGCCATTAAGTACAAAAAAGG - Intergenic
923825815 1:237499066-237499088 TCAACCATTAAGAAGAAAACAGG - Intronic
1064092559 10:12397214-12397236 TCAGCTCTTATGTTAAAAACAGG - Intronic
1066472423 10:35712065-35712087 TCCCCCATAATGTTAAAACCAGG - Intergenic
1067913684 10:50373660-50373682 TCAGTCATAAAGATAAAAACTGG + Intronic
1068619222 10:59160815-59160837 AAACCCACTAAGGTAAAAACTGG + Intergenic
1070413808 10:76170179-76170201 TCACCCAAGAAGGTATAAACTGG + Intronic
1073956935 10:108883273-108883295 TCACCCATGAACATAAAATCAGG + Intergenic
1076275155 10:129192362-129192384 TTACCCTTTAAATTAAACACAGG - Intergenic
1078678837 11:13455212-13455234 TCACCCTTTAAGTGGACAACAGG - Intronic
1078791495 11:14547139-14547161 TCTGCCATTAATTTGAAAACTGG + Intronic
1079887911 11:26011973-26011995 TCTATCATTAATTTAAAAACTGG + Intergenic
1080820553 11:35801915-35801937 TCAGGAATTAATTTAAAAACGGG - Intronic
1081476941 11:43442813-43442835 TCAGCCATTTAGTGAAAAATGGG + Intronic
1082129262 11:48468525-48468547 TAATCCATTAAGTTACCAACAGG + Intergenic
1082562796 11:54639417-54639439 TAATCCATTAAGTTACCAACAGG + Intergenic
1082692449 11:56323257-56323279 TCACTCATTATCATAAAAACAGG - Intergenic
1087417532 11:97876808-97876830 TCATACATTGAGTTAAAAATGGG - Intergenic
1087851491 11:103035462-103035484 TCACCCATTAATTTAGTTACTGG + Intergenic
1091834174 12:3573218-3573240 TAACCAATAAAGTTGAAAACGGG - Intronic
1093700712 12:22217357-22217379 TCACCATTTAAGTAAAAAAATGG + Intronic
1097484328 12:60175505-60175527 ACACCCAATGATTTAAAAACAGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098587592 12:72172187-72172209 TCATCTATTAAGTAACAAACGGG + Intronic
1099446409 12:82757137-82757159 TCTACCACTAAGTCAAAAACAGG - Intronic
1102328313 12:112008518-112008540 TAGCCCAATAAGTTAAGAACTGG - Intronic
1104654303 12:130561687-130561709 TCATCCCTTAATTTAAAAATGGG - Intronic
1109766623 13:66908948-66908970 ATACACATTAATTTAAAAACAGG + Intronic
1117670326 14:58099706-58099728 TGACCCATTAACTTACAAGCAGG - Intronic
1118016646 14:61667676-61667698 TCACCCAAAATGTTCAAAACTGG + Intergenic
1118350186 14:64968070-64968092 TCATTCATTAATTTAACAACAGG + Intronic
1120729146 14:87982353-87982375 TATCCCATAAAGTTAAAAAATGG - Intronic
1123166353 14:106329029-106329051 TCACACATTATGGTCAAAACAGG - Intergenic
1123698657 15:22898185-22898207 TTACTCCTTAAGTGAAAAACTGG - Intronic
1124793530 15:32753015-32753037 TCTCCTATTAAGGTAAAGACTGG - Intergenic
1124887881 15:33703850-33703872 TAAATCATTAAGTTAAAAGCAGG + Intronic
1124940588 15:34213958-34213980 TTGCACATTAAGGTAAAAACCGG - Intergenic
1130514743 15:84617626-84617648 TCACCTTTAAAGTTGAAAACAGG - Intronic
1137586209 16:49665253-49665275 TCACCCATTTAGTTATTCACAGG + Intronic
1138049334 16:53760049-53760071 TCAACCATGAAGCTGAAAACAGG - Intronic
1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG + Exonic
1138783463 16:59816673-59816695 ACAGACTTTAAGTTAAAAACTGG + Intergenic
1139173906 16:64663720-64663742 TCACACATCAATTTAAAACCAGG + Intergenic
1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG + Intergenic
1143690176 17:8555762-8555784 TGAACCATAAAATTAAAAACTGG + Intronic
1148173309 17:45542398-45542420 TAGCCCATTAAGTTAAGAATGGG - Intergenic
1148275959 17:46303053-46303075 TAGCCCATTAAGTTAAGAATGGG + Intronic
1148298073 17:46520627-46520649 TAGCCCATTAAGTTAAGAATGGG + Intronic
1148827390 17:50404123-50404145 TGACCCAGTACGTTAACAACTGG - Intergenic
1150404516 17:64889315-64889337 TAGCCCATTAAGTTAAGAATGGG - Intronic
1160481296 18:79242067-79242089 TCAGGCATTAAAATAAAAACTGG - Intronic
1163103586 19:15110916-15110938 TCATCCATTGATTTAAAAACAGG + Intronic
1163623867 19:18377072-18377094 TTCCCCATTAAGTTCAATACAGG + Intronic
1167836794 19:52079480-52079502 TCACCCAACAAGTGAAACACTGG + Intronic
1168666491 19:58208872-58208894 TCACCCCTGAGGTTAAACACAGG - Intronic
925771442 2:7286325-7286347 TCAGCCAAGACGTTAAAAACAGG + Intergenic
930487847 2:52030697-52030719 ATACCCATTAAATTAAAAACAGG + Intergenic
930900529 2:56501930-56501952 TCAGCCATTAAATTAATAATTGG + Intergenic
932322045 2:70829513-70829535 AAACCCATTAAGTAGAAAACTGG + Intergenic
934593370 2:95579370-95579392 TTACCCTTCAAGTTATAAACTGG - Intergenic
936721167 2:115254314-115254336 TCACTCATTATGATGAAAACAGG + Intronic
938896811 2:135760136-135760158 TCACCCATAAAGTTACACATGGG + Intronic
940170488 2:150824871-150824893 TCACCTATGAATTAAAAAACGGG - Intergenic
940432211 2:153606106-153606128 GCACCCATTAGGTTGAAAGCAGG + Intergenic
941607220 2:167613574-167613596 GCATCCATTAATTTAAAAATTGG - Intergenic
942401842 2:175611011-175611033 TCACACATGAAGGCAAAAACAGG - Intergenic
943462408 2:188184923-188184945 ACACCAATTAAGTTAAAAACAGG - Intergenic
943569251 2:189553738-189553760 TCTCCCATTAAGTCAACCACTGG + Intergenic
944587985 2:201189573-201189595 ATACCAATTAACTTAAAAACTGG - Intronic
946407377 2:219498792-219498814 TCTCCCATAAAGTTAGAAAGCGG + Intergenic
947256884 2:228176538-228176560 TCAGCCATTAATTTCAGAACAGG + Intronic
948088320 2:235268636-235268658 TCATCCATTAGGTTAAAAATCGG - Intergenic
1170268449 20:14496920-14496942 TCAACCATTAAAATAACAACAGG - Intronic
1172332906 20:34088159-34088181 TCAAGAATGAAGTTAAAAACGGG + Intronic
1172372891 20:34409150-34409172 TTAAAAATTAAGTTAAAAACCGG - Intronic
1174559494 20:51420080-51420102 CAACCCATTATTTTAAAAACTGG + Intronic
1179493758 21:41758687-41758709 TCACTCATTCATTTAAACACTGG + Intronic
1184951863 22:47848814-47848836 TTACCCTTTTAATTAAAAACAGG + Intergenic
952224613 3:31362584-31362606 TTTCCCAGTAAGTTAAAATCAGG - Intergenic
954394692 3:50287334-50287356 GCAGCCATTAAGTTAACAACAGG - Exonic
956599750 3:71008192-71008214 TTACCTTCTAAGTTAAAAACAGG + Intronic
960214504 3:115014909-115014931 TCACCCATAAACTTATAAAGTGG + Intronic
960648160 3:119913343-119913365 TTACCCAATAAATTATAAACAGG + Intronic
960677465 3:120210183-120210205 TCAACCATGAAGTTAGAAAATGG + Intronic
964624159 3:158742926-158742948 TCACCAAATAATTTAAATACAGG - Intronic
964636522 3:158863542-158863564 TCAGCCACTAAATAAAAAACTGG + Intergenic
965193823 3:165567968-165567990 TAATCAATGAAGTTAAAAACAGG - Intergenic
966386419 3:179403883-179403905 TCTCCCATTATGTTGAAAATGGG - Intronic
971152388 4:24047118-24047140 TCACTCATTGAGTCAAAAAATGG - Intergenic
973966514 4:56168442-56168464 GCAAGCATTAAGTTAAAAATTGG - Intergenic
974424816 4:61727690-61727712 TAACCCATTAAATATAAAACTGG - Intronic
976411106 4:84714411-84714433 TTACCTTTTAAGTGAAAAACAGG - Intronic
977143110 4:93400463-93400485 TAACTCAGGAAGTTAAAAACGGG - Intronic
977346841 4:95826593-95826615 TCACCCATAAAGTAAAAATTAGG - Intergenic
979190071 4:117845919-117845941 TCTCACATTAAATTAAAAGCTGG + Intergenic
982033447 4:151324053-151324075 TTACCAATTATGTTCAAAACTGG + Intronic
987333853 5:16881050-16881072 TTACTCATTAGGTTAAAATCAGG + Intronic
987462319 5:18226700-18226722 TGAACAATTAAGTTAAAAAATGG - Intergenic
987566166 5:19589455-19589477 TCACCCATAAAATGAAAAGCAGG + Intronic
987789012 5:22539440-22539462 TCACCCATTCATTTATTAACTGG - Intronic
989045195 5:37267476-37267498 TGACCCATCTAGTTATAAACTGG - Intergenic
989125173 5:38046096-38046118 TTACCTATTAAGTAAGAAACTGG + Intergenic
991678738 5:69116468-69116490 TCACCCATGAAGTTATAAAGAGG - Exonic
996364972 5:122691684-122691706 TTAATCATTAAGTTAAAAAATGG - Intergenic
996485763 5:124032101-124032123 TAACCCATTAAATTAAAAATTGG - Intergenic
997024602 5:130043806-130043828 TCTCCAATGAAGTTAAAGACTGG - Intronic
998280184 5:140798492-140798514 TCAACCATTAACATAAAGACTGG - Intronic
998567281 5:143226672-143226694 TCAGACATTAAGCTAAAGACTGG - Intronic
1002957489 6:1881121-1881143 TCAACTATTAATTTAAAAACAGG + Intronic
1004431401 6:15547638-15547660 TCACCCATAAGGTTGACAACAGG - Intronic
1004951232 6:20674350-20674372 TCCCCCATTAAGTAAGATACTGG + Intronic
1005949637 6:30622237-30622259 TCAGCCTTTAGGTGAAAAACTGG - Intronic
1008994573 6:57643645-57643667 TCACCCAATTCATTAAAAACTGG - Intronic
1009491294 6:64295231-64295253 GCACCCATTAACTAAAAAAACGG - Intronic
1009519587 6:64664308-64664330 ACACCAATTAGGCTAAAAACAGG - Intronic
1009724782 6:67524517-67524539 TCACACATTAACTGAAAAAAAGG + Intergenic
1010573796 6:77508754-77508776 TCCACCATCCAGTTAAAAACTGG - Intergenic
1015030179 6:128585825-128585847 TCAGCAATAAAGTTAAAACCAGG - Intergenic
1015047144 6:128789469-128789491 GCACCCGTTCAGTTCAAAACAGG - Intergenic
1019916683 7:4137659-4137681 TCACCCATACCCTTAAAAACAGG + Intronic
1022494163 7:30842943-30842965 TCCCCCATTAAGATAAAACCAGG + Intronic
1023212557 7:37823565-37823587 TCCCCGAAAAAGTTAAAAACTGG - Intronic
1024347117 7:48324353-48324375 TCATCAATTAAGTTAAAATGAGG - Intronic
1026537829 7:71254803-71254825 TCACCCAGCAAGCTGAAAACAGG + Intronic
1028222998 7:88219113-88219135 ACACCCCGTAATTTAAAAACTGG + Intronic
1030876210 7:114816637-114816659 TTACCCATTTATGTAAAAACAGG - Intergenic
1031339991 7:120588060-120588082 GCATGCATTAAGATAAAAACAGG - Intronic
1031690235 7:124779121-124779143 GCACTCAATCAGTTAAAAACTGG - Intronic
1031741520 7:125437707-125437729 TCACCCATTAAGTCAGATAGGGG + Intergenic
1034864568 7:154630105-154630127 TCACCCAGCAAGTGAATAACAGG + Intronic
1035302283 7:157905433-157905455 TCTCCCATGAAGATAAAAACGGG - Intronic
1036563658 8:9919564-9919586 TCACCCTTTAAGAGAAAAGCAGG - Intergenic
1037058605 8:14478197-14478219 TACCCAATGAAGTTAAAAACAGG + Intronic
1039396916 8:37234297-37234319 TCACCAATTAAATTAAAGAGTGG - Intergenic
1039404666 8:37302233-37302255 TCACCCAGCAAGTTAGGAACAGG + Intergenic
1039627998 8:39075436-39075458 TCATCCATAAAGTGAAACACTGG - Intronic
1039840972 8:41292840-41292862 ACACACATTCATTTAAAAACAGG - Intronic
1040474063 8:47761652-47761674 TCACCAATTAAGGTAACGACAGG + Intergenic
1041793839 8:61725584-61725606 TACCCCATTAAGGTAAAAATTGG + Intergenic
1042566696 8:70118546-70118568 GCACACAGTAAGTTAAAATCTGG + Intronic
1043387401 8:79761840-79761862 TCACCCAATTAGGTAAAAGCAGG + Intergenic
1043649495 8:82573195-82573217 TTACCCATTAAATTGAAAATTGG + Intergenic
1045110940 8:98939377-98939399 TCACCTACTAAGTCAGAAACTGG - Intronic
1045335494 8:101199857-101199879 TTACACATTAACTTAAAAAGGGG + Intronic
1045365132 8:101469209-101469231 TCACCCATAAACCTACAAACTGG + Intergenic
1046535220 8:115500562-115500584 TCACACATCAAGTGATAAACTGG - Intronic
1047260396 8:123253605-123253627 TCACTCATAAAATTTAAAACTGG - Exonic
1048120673 8:131577721-131577743 TCACCCATTATTTTGATAACAGG - Intergenic
1056647868 9:88430587-88430609 TCACCCTCTATGTTAAAGACAGG - Intronic
1060384974 9:123217080-123217102 TCACCCAATAACTTAAAGTCAGG + Intronic
1190014103 X:46811797-46811819 ACTCCCATTAATTTAAAAAATGG - Intergenic
1194818092 X:98469943-98469965 TAACCAATTAAGATAAAATCAGG - Intergenic
1195566763 X:106347889-106347911 TCCCCAATTAAGTTAAAGACTGG - Intergenic
1198033892 X:132782113-132782135 GAATCCCTTAAGTTAAAAACAGG - Intronic
1199133861 X:144228792-144228814 ACAGCCTTTAAGTCAAAAACAGG - Intergenic
1199503197 X:148532302-148532324 TCCAACATTAAGTTAAAAAATGG - Intronic
1200693831 Y:6337954-6337976 TCTCCCATTAATTAAAAATCTGG - Intergenic
1201041446 Y:9836765-9836787 TCTCCCATTAATTAAAAATCTGG + Intergenic
1201957140 Y:19637980-19638002 TCACCCAGTAAATGAAACACTGG - Intergenic