ID: 917789441

View in Genome Browser
Species Human (GRCh38)
Location 1:178490146-178490168
Sequence AGAGGACTGTGCACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917789441_917789445 3 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG No data
917789441_917789452 23 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789452 1:178490192-178490214 AGGAGGGGATGCTGGCCCCCAGG No data
917789441_917789450 15 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789450 1:178490184-178490206 CTGCAGCCAGGAGGGGATGCTGG No data
917789441_917789448 8 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789448 1:178490177-178490199 TCGGCACCTGCAGCCAGGAGGGG No data
917789441_917789446 6 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789446 1:178490175-178490197 CATCGGCACCTGCAGCCAGGAGG No data
917789441_917789453 30 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789453 1:178490199-178490221 GATGCTGGCCCCCAGGTCACTGG No data
917789441_917789447 7 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789447 1:178490176-178490198 ATCGGCACCTGCAGCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917789441 Original CRISPR AGAGGACTGTGCACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr