ID: 917789445

View in Genome Browser
Species Human (GRCh38)
Location 1:178490172-178490194
Sequence CATCATCGGCACCTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917789441_917789445 3 Left 917789441 1:178490146-178490168 CCAAGAGCTGTGCACAGTCCTCT No data
Right 917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917789445 Original CRISPR CATCATCGGCACCTGCAGCC AGG Intergenic
No off target data available for this crispr