ID: 917791933

View in Genome Browser
Species Human (GRCh38)
Location 1:178504517-178504539
Sequence TGGTCAGCTACCCTGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917791927_917791933 -7 Left 917791927 1:178504501-178504523 CCTGCAGTCCACCCAGTGGTCAG No data
Right 917791933 1:178504517-178504539 TGGTCAGCTACCCTGAGGCTGGG No data
917791923_917791933 22 Left 917791923 1:178504472-178504494 CCTGAGAAGGAAGGTCAAGAGAG No data
Right 917791933 1:178504517-178504539 TGGTCAGCTACCCTGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917791933 Original CRISPR TGGTCAGCTACCCTGAGGCT GGG Intergenic
No off target data available for this crispr