ID: 917792984

View in Genome Browser
Species Human (GRCh38)
Location 1:178511752-178511774
Sequence CAAAATTAGCAGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917792971_917792984 21 Left 917792971 1:178511708-178511730 CCAAGCAAGGGAAGCTCTACTGC 0: 1
1: 0
2: 3
3: 11
4: 166
Right 917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG 0: 1
1: 0
2: 3
3: 30
4: 379
917792975_917792984 -6 Left 917792975 1:178511735-178511757 CCAGGAGGCCCCCAAGCCAAAAT 0: 1
1: 0
2: 2
3: 21
4: 146
Right 917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG 0: 1
1: 0
2: 3
3: 30
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917792984 Original CRISPR CAAAATTAGCAGAAGGAGGT GGG Intergenic
900032751 1:382822-382844 AAAAATTAGCCGAATGTGGTGGG + Intergenic
900053594 1:612712-612734 AAAAATTAGCCGAATGTGGTGGG + Intergenic
901481556 1:9528744-9528766 AAAAATCAGCACAAAGAGGTTGG + Intergenic
903407687 1:23111973-23111995 CAAATTTGGCAGTAGGTGGTAGG - Intronic
903558379 1:24209850-24209872 AAAAATTAGCTGAGGGCGGTGGG + Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
906602201 1:47139693-47139715 TATGATTATCAGAAGGAGGTGGG + Intronic
907659743 1:56381049-56381071 CAAACTTAGAAGAAGGAGAAAGG + Intergenic
910633468 1:89381540-89381562 TGATAATAGCAGAAGGAGGTAGG + Intronic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
911610708 1:99956603-99956625 AAATATTAGAAGAATGAGGTTGG - Intergenic
913491866 1:119388094-119388116 CAAACTTAGGAGAAAGTGGTTGG + Intronic
913537978 1:119792606-119792628 ATAAATTAGGAGAGGGAGGTGGG + Intergenic
914837982 1:151223835-151223857 AAAAATTAGCTGAATGTGGTAGG + Intronic
915134980 1:153724910-153724932 CAAAATTAGCCGGGGGTGGTGGG - Intergenic
915877480 1:159627033-159627055 CAAAGTAAGCAGAAGGTGATTGG - Intergenic
916407003 1:164507827-164507849 GAAAGTTAGTAGAAGGAGGTAGG - Intergenic
917360466 1:174169844-174169866 AAAAATTAGCAGAGTGTGGTGGG - Intronic
917745798 1:178005730-178005752 AGAAATTAGCAGAAGGAAGAGGG - Intergenic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
919305321 1:195826130-195826152 CAAAAGTAGCATAAGGACCTAGG - Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
920391682 1:205607455-205607477 CAAAATTAGCTGGACGTGGTGGG - Intronic
920628084 1:207623429-207623451 CAAAATTAGCTGGGCGAGGTGGG + Intronic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
922072828 1:222213200-222213222 CAATATTGGCAGAAGGGGGAGGG + Intergenic
923860582 1:237888754-237888776 CAAAATTGGTAGAAGCAGTTGGG + Intronic
923891331 1:238218197-238218219 CAAATTGAGAAGAAGGAAGTTGG - Intergenic
924202473 1:241674406-241674428 CAAAATTAGCTGAATGTGATGGG - Intronic
924336316 1:242989858-242989880 AAAAATTAGCCGAATGTGGTGGG + Intergenic
1063325453 10:5096438-5096460 CAAAATTAGCAATAGAAGCTGGG + Exonic
1063346720 10:5318704-5318726 CAATGGTAGGAGAAGGAGGTTGG - Intergenic
1063528106 10:6803177-6803199 CAATATTTGCAGAAGGAGTCAGG + Intergenic
1064862473 10:19842717-19842739 CAAATTTAGAAGAAGGATGTAGG + Intronic
1065456967 10:25916992-25917014 CAAATCTAGCAGCAGGAGGGAGG - Intergenic
1065917789 10:30366980-30367002 CACACTTAGCAGATGGTGGTTGG - Intronic
1066457336 10:35583838-35583860 GGAAAGTAGCAGAATGAGGTTGG - Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1071798856 10:89035416-89035438 AAAAAATAGCAGAAGCAGGAAGG - Intergenic
1073157560 10:101359894-101359916 GAAAATTAGCAAAAAGAGGCCGG - Intronic
1074540465 10:114361316-114361338 CAACATGAGCAGAAAAAGGTGGG + Intronic
1075108073 10:119555792-119555814 GAAAATTGGCAGAATAAGGTGGG + Intergenic
1075163695 10:120046983-120047005 CAGAATTGGCAGCAGGTGGTAGG + Intergenic
1075837284 10:125465363-125465385 TAAAATTAGCAGTAAGGGGTAGG + Intergenic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1077808835 11:5616886-5616908 AAAAATTAGCCGAAGGTGGCAGG - Intronic
1078212234 11:9279141-9279163 CAAAATTAGCTGAGTGTGGTGGG + Intergenic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1079561233 11:21822236-21822258 CAATAAAAGCAAAAGGAGGTGGG + Intergenic
1079933777 11:26594214-26594236 CAAAATCAGAAGATGGAGATTGG - Intronic
1080064732 11:27998443-27998465 TAAAATTTTCAGAAAGAGGTAGG + Intergenic
1080525886 11:33117033-33117055 TAAAGTTAGCAGATGGGGGTTGG + Intronic
1081173736 11:39900369-39900391 CAATACTGGAAGAAGGAGGTGGG - Intergenic
1082040070 11:47677603-47677625 CAAAATTAGCTGAGTGTGGTGGG - Intronic
1082054149 11:47799235-47799257 AAAAATTAGCTGAACGTGGTGGG - Intronic
1082611808 11:55308447-55308469 CAAAATTAGCAGGGGGTGGGGGG + Intergenic
1082632356 11:55557538-55557560 CTAGATTAGCAGAAGAATGTGGG + Intergenic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1087268538 11:96087226-96087248 GAAAATTAGCAGGAGGAACTTGG - Intronic
1087285590 11:96261594-96261616 CAATATTATCAGAAGGACTTGGG - Intronic
1087477366 11:98653053-98653075 CAAATTTTGCAGAAGTATGTGGG + Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1089221679 11:116877135-116877157 CAAAATTAGAAGCAGGGAGTTGG - Intronic
1096325200 12:50654167-50654189 CAAAATTAGCAGAAGGTGCTGGG - Intronic
1096754174 12:53785104-53785126 CAAAATTAGAAGCAGGAGCTGGG - Intergenic
1097031020 12:56089403-56089425 CAAAACTTTAAGAAGGAGGTTGG - Intronic
1097871392 12:64605132-64605154 AAAAATTAGCTGAATGTGGTGGG - Intergenic
1099408284 12:82290258-82290280 GAAAATTAGTAGAAAGAGATAGG - Intronic
1099967839 12:89469638-89469660 ACAAATTAGCAGAAGGAGTGAGG + Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100981394 12:100165535-100165557 CACAGTTAGCAGATGGTGGTTGG - Intergenic
1102215695 12:111160047-111160069 CAAAAAAAGCAAAAGGAGTTAGG + Intronic
1102516399 12:113449770-113449792 CAAGACTAGCAGCAGGAGGCTGG - Intergenic
1103990471 12:124795704-124795726 CAAAATGATCAGGAGGAGTTGGG - Intronic
1104515292 12:129419484-129419506 AAACTTTAGCAGAAGGAGGATGG + Intronic
1105309740 13:19195746-19195768 AAAAATTTTCAGAAGGAGGTCGG + Intergenic
1106440944 13:29769526-29769548 TAAAATTAGGAGATGGGGGTTGG + Intronic
1107072495 13:36286333-36286355 CAAAAGAGGCAGAAGGTGGTTGG - Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108950246 13:56083617-56083639 AGAAAATAGCAGAAGGAGGGTGG + Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110928322 13:81183669-81183691 CAAAATGACCATAAGGAAGTAGG - Intergenic
1112563106 13:100531198-100531220 GACAATTATCAGATGGAGGTGGG + Exonic
1113052316 13:106227787-106227809 CAAAATTAGCAGGGTGTGGTGGG + Intergenic
1113399168 13:109975592-109975614 CAGAATTAGCAGTTGGTGGTGGG + Intergenic
1115269621 14:31537403-31537425 CAAAATTAGTAGAGGGAGATGGG + Intronic
1116562459 14:46398158-46398180 AAAAATTAGTAGAGGGATGTCGG - Intergenic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1116796801 14:49399891-49399913 TAAATTCAGAAGAAGGAGGTAGG + Intergenic
1117116083 14:52514001-52514023 CAAAATCAGCAGAATGAGACAGG + Intronic
1117215323 14:53545601-53545623 GAAGATTAGGAAAAGGAGGTGGG + Intergenic
1117652186 14:57918642-57918664 GAAAATTTGCAGAACGAGGAAGG + Intronic
1119039888 14:71263745-71263767 AAAAATTAGCCGGAGGTGGTGGG - Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119722415 14:76900157-76900179 CAAAAGTAGAAGAAGGAGATGGG + Intergenic
1120049083 14:79844278-79844300 CAACATTAGCAGGAGGTGGGAGG - Intronic
1122539304 14:102488489-102488511 CAAAATTAGCCGGACGTGGTGGG - Intronic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1123473263 15:20570185-20570207 CACATTTAGCAGATGGTGGTTGG + Intergenic
1123644745 15:22430168-22430190 CACATTTAGCAGATGGTGGTTGG - Intergenic
1123733563 15:23165196-23165218 CACATTTAGCAGATGGTGGTTGG + Intergenic
1123751695 15:23362571-23362593 CACATTTAGCAGATGGTGGTTGG + Intronic
1124161668 15:27275872-27275894 GACAATGAGCACAAGGAGGTGGG + Intronic
1124284067 15:28386496-28386518 CACATTTAGCAGATGGTGGTTGG + Intronic
1124298630 15:28525118-28525140 CACATTTAGCAGATGGTGGTTGG - Intronic
1125351170 15:38769104-38769126 CCATATTAGCAGAAAGAGATGGG - Intergenic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1125586280 15:40822600-40822622 AAAAATTAGCAGGACGTGGTAGG - Intronic
1125755495 15:42061500-42061522 AAAAATTAGCAGATGGTGGGGGG + Intergenic
1125991047 15:44108490-44108512 CAAAATTAGCCGAGCGTGGTGGG + Intronic
1126839940 15:52708131-52708153 CAAAATGAAGGGAAGGAGGTTGG + Intronic
1127772966 15:62245227-62245249 CACACTTAGCAGATGGTGGTTGG - Intergenic
1127988124 15:64090882-64090904 TAAAATAAGCAGAAGGGAGTGGG + Intronic
1128928129 15:71677657-71677679 AACAATCAGCAGAAGGGGGTGGG - Intronic
1129029991 15:72611112-72611134 CACACTTAGCAGATGGTGGTTGG + Intergenic
1129038210 15:72663860-72663882 CACACTTAGCAGATGGTGGTTGG + Intronic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1129211680 15:74073371-74073393 CACACTTAGCAGATGGTGGTTGG - Intronic
1129344947 15:74911309-74911331 CAAAATTAGCCGGACGTGGTGGG + Intergenic
1129398723 15:75267713-75267735 CACACTTAGCAGATGGTGGTTGG + Intronic
1129402331 15:75291989-75292011 CACACTTAGCAGATGGTGGTTGG + Intronic
1129475872 15:75784424-75784446 CACACTTAGCAGATGGTGGTTGG + Intergenic
1129594904 15:76955220-76955242 TAAATTTAGCAGAAGGAAGGTGG - Intergenic
1129728802 15:77917646-77917668 CACACTTAGCAGATGGTGGTTGG - Intergenic
1129839716 15:78736225-78736247 CACACTTAGCAGATGGTGGTTGG + Intergenic
1130259357 15:82343465-82343487 CACACTTAGCAGATGGTGGTTGG - Intronic
1130269321 15:82435700-82435722 CACACTTAGCAGATGGTGGTTGG + Intronic
1130281909 15:82525717-82525739 CACACTTAGCAGATGGTGGTTGG + Intergenic
1130473275 15:84241880-84241902 CACACTTAGCAGATGGTGGTTGG + Intronic
1130480690 15:84355944-84355966 CACACTTAGCAGATGGTGGTTGG + Intergenic
1130484887 15:84393371-84393393 CACACTTAGCAGATGGTGGTTGG + Intergenic
1130491022 15:84431815-84431837 CACACTTAGCAGATGGTGGTTGG - Intergenic
1130502606 15:84510614-84510636 CACACTTAGCAGATGGTGGTTGG - Intergenic
1130595561 15:85246475-85246497 CACACTTAGCAGATGGTGGTTGG + Intergenic
1131188196 15:90293234-90293256 CACACTTAGCAGATGGTGGTTGG + Intronic
1131282631 15:91033561-91033583 CACACTTAGCAGATGGTGGTTGG - Intergenic
1132383416 15:101382403-101382425 TAAATTTAGCAGAAGGAGTTGGG - Intronic
1133380122 16:5322788-5322810 CAAAATAAGTAGAATAAGGTAGG - Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134680309 16:16120402-16120424 CAAAGCTTGCAGAAGGTGGTTGG + Intronic
1135289013 16:21218635-21218657 CAAAATTAGCCGAGTGTGGTGGG - Intergenic
1135685106 16:24492606-24492628 AAAAATTAGCTGACTGAGGTGGG - Intergenic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1140092549 16:71850217-71850239 CAAGGTTGGCAGAAGGAGATAGG - Exonic
1140438710 16:74969896-74969918 AAAAATTAGCAGGCTGAGGTGGG - Intronic
1140467146 16:75191596-75191618 CAAAATTAGGAGCAGGGGGAGGG + Intergenic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1142656303 17:1396772-1396794 CAAAATTAGCCGGGGGTGGTGGG - Intronic
1142938082 17:3354780-3354802 CAAAATTAGTAAAAGAAGGGAGG - Intergenic
1143600899 17:7945196-7945218 CATAATTAAAAGAAGGAAGTGGG - Intronic
1146032943 17:29381930-29381952 CAATATTAGTAGAGGGGGGTGGG + Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1147119102 17:38325107-38325129 CAAGATTGGCAAAGGGAGGTGGG - Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147846457 17:43407320-43407342 CAAATTTAATAGGAGGAGGTAGG - Intergenic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148775240 17:50091550-50091572 GAAAATTAACAGAAGGACCTAGG - Intergenic
1150332459 17:64305236-64305258 CAAAATTAAAAAAAGGAGGCGGG - Intergenic
1150652158 17:67017226-67017248 AAAAATTAGCTGAATGTGGTGGG - Intronic
1150660069 17:67067525-67067547 CAAAATTAACAGAAGATGATTGG - Intergenic
1150669694 17:67181959-67181981 CATAAATAGCAGAAGGATGTGGG + Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152037999 17:77885123-77885145 GACATTTGGCAGAAGGAGGTGGG - Intergenic
1153036913 18:772179-772201 CAAAATTAGCTGGATGTGGTGGG - Intronic
1153440740 18:5116683-5116705 GAAAATTAGCACCAGGAGTTGGG + Intergenic
1154254072 18:12767711-12767733 AAAAATTAGCTGGAGGTGGTGGG + Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1155163516 18:23214660-23214682 CAAAAGGAGCACAAGGAGGAAGG - Intronic
1156235823 18:35203856-35203878 CATACTTAGCAGAAGGAGTGGGG - Intergenic
1157976163 18:52329490-52329512 TAAAAATAACAAAAGGAGGTAGG - Intergenic
1158013179 18:52752357-52752379 CAAAAGTTGCAGTAGCAGGTAGG + Exonic
1158217774 18:55117724-55117746 AAAAAGTAGAAGAAGGAGGAGGG + Intergenic
1159118378 18:64140825-64140847 CAAAAATAGAAAAGGGAGGTAGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160032804 18:75277708-75277730 CAGTAATGGCAGAAGGAGGTAGG - Intronic
1160753812 19:747608-747630 CCAAATTAGCACCAGGAGGAAGG - Exonic
1161071069 19:2261368-2261390 CAAAATTAGCAAAAATAGGCCGG - Intronic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1162260811 19:9532446-9532468 AAAAATTAGCCGAGGGTGGTGGG - Intronic
1162297949 19:9826488-9826510 AAAAATTAGCCGAGGGTGGTGGG + Intronic
1162518380 19:11164028-11164050 CAAAATTAGCCGAGTGTGGTGGG + Intergenic
1162562436 19:11424350-11424372 CAAAATTAGCAGGGCGTGGTGGG + Intronic
1162591729 19:11596685-11596707 TAAAATTAGCAGAGTGTGGTGGG + Intronic
1164842321 19:31401726-31401748 AAAAATTAGCAGGATGTGGTGGG + Intergenic
1165597883 19:37026158-37026180 CAAAATTAGCTGGCGGGGGTGGG + Intronic
925261774 2:2535578-2535600 CAAAATTACAAGAAGAAAGTAGG - Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
927791138 2:26010501-26010523 AAAAATTAGCCGAACGTGGTAGG + Intergenic
928542438 2:32295753-32295775 CAAAATTAGCTGGGGGTGGTGGG - Intronic
929113890 2:38428342-38428364 AAAAAATAGAAGAAGGAGATAGG - Intergenic
929113913 2:38428485-38428507 AAAAAATAGAAGAAGGAGGGTGG - Intergenic
929378495 2:41320347-41320369 CAAAATCTGCAGATGGAGCTGGG + Intergenic
929672567 2:43888847-43888869 TAAAGCTAGCAGCAGGAGGTAGG + Intronic
930176697 2:48308216-48308238 CAAAATTACCAAAAGGAAGCTGG - Intergenic
930274624 2:49297071-49297093 TAAGATTAGCATAAGCAGGTGGG - Intergenic
930421412 2:51157690-51157712 CCAAATTCCCAGAAGGAGGTAGG - Intergenic
931827936 2:66020649-66020671 CACAATTTGCTGAAGGAGCTAGG - Intergenic
932943943 2:76204755-76204777 CAAATTTAACAGAAGGGGGCAGG - Intergenic
933017804 2:77152112-77152134 CATAATTACCAGAAGGCGTTAGG - Intronic
933929048 2:87129902-87129924 AAAATTTAGCAAAAAGAGGTTGG + Intergenic
934000382 2:87705687-87705709 AAAATTTAGCAAAAAGAGGTTGG + Intergenic
935052378 2:99534745-99534767 CAAAATTAGCAAAATTAGCTAGG + Intergenic
935291002 2:101610968-101610990 CAAAATTTGCAGCAGAAGGCAGG - Intergenic
937554637 2:123138566-123138588 AAAAATTAGCAGATCGAGGAAGG - Intergenic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
941128860 2:161621696-161621718 TTAAAATAGCAAAAGGAGGTAGG + Intronic
941811336 2:169758669-169758691 AAAAATTAGCTGGAGGTGGTGGG - Intronic
941823222 2:169863916-169863938 CAAAATGACATGAAGGAGGTAGG - Intronic
941836000 2:170021550-170021572 CAAGGTTAGTATAAGGAGGTGGG - Intronic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
947189461 2:227487119-227487141 AGAAATTAACAGAAGGAGGGCGG - Intronic
947921655 2:233880534-233880556 AAAAATTAGCTGAGGGTGGTGGG + Intergenic
1168953283 20:1817240-1817262 CAGCCTTGGCAGAAGGAGGTGGG + Intergenic
1169564344 20:6837230-6837252 CAAAATTCACAGAAAAAGGTAGG + Intergenic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172518448 20:35552118-35552140 CAAACTTAGCACCAGGAGGAAGG + Intronic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1175164424 20:57033238-57033260 CAAAATTGGGATGAGGAGGTGGG + Intergenic
1176185673 20:63777313-63777335 CAAAATTAGCTGAGTGTGGTGGG + Intronic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1177068812 21:16475552-16475574 CAAGATTAGCAGAATGTGGAAGG - Intergenic
1177152492 21:17468959-17468981 CAAAAGCAGCAGAAGTTGGTGGG + Intergenic
1177597134 21:23259107-23259129 CAAAATCAGCAAAATGAGGCAGG + Intergenic
1178009476 21:28266741-28266763 AAAAATTAGCACAATGAGGTGGG - Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183548390 22:38467611-38467633 CCAAATTAACAGACGGAGGTGGG + Intergenic
1183881477 22:40835065-40835087 AAAAATTAGGAGAAGGCGGGGGG - Intronic
949335131 3:2966465-2966487 AACAATTACCAGAAGGAGGGAGG + Intronic
951052023 3:18104522-18104544 CAAATCTAGCAGAAGTAGCTAGG - Intronic
952577648 3:34794406-34794428 CTCAGTTGGCAGAAGGAGGTGGG - Intergenic
953305134 3:41821971-41821993 CAAAATTAGGAGAGAGAAGTGGG - Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955862760 3:63349735-63349757 CAAAATGAGTAGAAGGAACTTGG - Intronic
956564909 3:70625346-70625368 CACAATTTGCTGAAGGAGCTCGG + Intergenic
957105453 3:75881887-75881909 TAATATTAGCAGAAGGAGTGTGG - Intergenic
958981567 3:100726287-100726309 CAAAACAGGCAGAAGAAGGTAGG - Intronic
958999957 3:100952064-100952086 GAATATTAGCAGGAGGAGCTGGG - Intronic
959734650 3:109644533-109644555 CAATATTAGCATCAGCAGGTTGG + Intergenic
959937383 3:112043397-112043419 TAAAATTATCCCAAGGAGGTGGG + Intronic
960460477 3:117928388-117928410 CAAGATGGGCAGAAGAAGGTGGG - Intergenic
961571636 3:127803404-127803426 GAGAATTAGAAGAAGCAGGTGGG - Intronic
961782294 3:129327354-129327376 AAAAATTAGCTGAACGTGGTGGG + Intergenic
962052706 3:131835027-131835049 TGAAATTAGCAGAAGTAGGGTGG - Intronic
962186974 3:133270538-133270560 CAAAAGCAGCAGCAGGTGGTAGG - Intronic
964736183 3:159920974-159920996 CAAAAATAGAAGGAGGAGGAAGG + Intergenic
964883689 3:161454314-161454336 GAAAATTAGCATTAGCAGGTAGG - Intergenic
966480817 3:180406448-180406470 CAAAAGGAGAAGAAGGAGATGGG + Intergenic
967923921 3:194632145-194632167 CAATATCAGCACCAGGAGGTAGG - Intronic
967937478 3:194740417-194740439 CAAAAAAAGCAGAGGGACGTGGG - Intergenic
968732368 4:2275400-2275422 TAAAATTAGAAGAACGAGTTGGG - Intronic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971637323 4:29077779-29077801 CAAACTTAGGAGAATTAGGTGGG - Intergenic
971935361 4:33140675-33140697 CAAAATTAGCACAAGCAGATGGG + Intergenic
972287542 4:37663204-37663226 CAAAAATAGCAAAAGGAGGAGGG - Intronic
972942786 4:44217664-44217686 CAAAACAGGCAGAAGAAGGTGGG + Intronic
972957351 4:44409089-44409111 CAAAATTAGCAGGGAGTGGTAGG + Intronic
973052814 4:45615342-45615364 TAAGTTTGGCAGAAGGAGGTTGG - Intergenic
973160569 4:47011171-47011193 AAACATTAGCAGAAAAAGGTGGG + Intronic
973289546 4:48456909-48456931 AAAAATTAGCAGGACGTGGTGGG + Intergenic
975115813 4:70679788-70679810 GAAAATTGACAGAAGGAAGTTGG - Intronic
975460118 4:74642184-74642206 CAAAATAAGCAGCAGTAGTTTGG + Intergenic
976148583 4:82068838-82068860 CAGAATTAGCATAAGAACGTGGG + Intergenic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
978784967 4:112599388-112599410 AAAAATGAGAAGAATGAGGTGGG + Intronic
979240805 4:118445452-118445474 AAAAATTAGCCGAATGTGGTGGG - Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
979606022 4:122639926-122639948 CAAAAGTAGCTGAAGTGGGTTGG + Intergenic
979886950 4:126040219-126040241 TAAAATTAGCAGAAGTAAGTGGG + Intergenic
980176913 4:129356990-129357012 CAAAATTAACAGGAGCAGGTGGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981168778 4:141596628-141596650 TAAAATTAGCACAAGGGGCTGGG + Intergenic
981700413 4:147601674-147601696 AAAATTTATCAGGAGGAGGTAGG + Intergenic
982691681 4:158554361-158554383 CAAAAATGGCAGAAGAAAGTGGG - Intronic
983849307 4:172560514-172560536 CAACATTTGCAGAAGGTTGTGGG + Intronic
983989791 4:174104152-174104174 AAAAATTTGTAGAATGAGGTAGG + Intergenic
985031528 4:185795292-185795314 CAAAAATAGAAGAAAGAGGTCGG + Intronic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
986396093 5:7332252-7332274 CAAAATTGGCAGCAGCAGGATGG + Intergenic
986680490 5:10228789-10228811 CAAAATTAGGAGGTTGAGGTGGG - Intronic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
990533879 5:56700958-56700980 CAAAATTAGCAGAAGCTGGGAGG + Intergenic
993631917 5:90296564-90296586 CAACATTAGCAGTGGCAGGTGGG - Intergenic
993981080 5:94544416-94544438 CAAAAATAACAGAATGAAGTAGG - Intronic
995085943 5:108109234-108109256 AGAAAATAGCAGAAGGAGGAAGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995640810 5:114255303-114255325 AAAACTTAGCTGAAGGAGATAGG + Intergenic
995897852 5:117035813-117035835 CAAATTTAGAAAAGGGAGGTTGG - Intergenic
997597684 5:135117978-135118000 CAGAATTAGCAGAATTAGCTTGG - Intronic
998222424 5:140296811-140296833 ACAAACTAGTAGAAGGAGGTAGG + Intronic
1000028885 5:157384617-157384639 CACCATTTTCAGAAGGAGGTTGG - Intronic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1002519816 5:179786086-179786108 AAAAATTAGCAGAGAGTGGTGGG + Intronic
1002741069 5:181436046-181436068 AAAAATTAGCCGAATGTGGTGGG - Intergenic
1003452926 6:6253378-6253400 CAATGTTAGCAGAAGCAAGTAGG + Intronic
1003523795 6:6881901-6881923 CCAAACTTGCAGATGGAGGTAGG - Intergenic
1003956006 6:11165464-11165486 CAAATTCATTAGAAGGAGGTAGG + Intergenic
1004357463 6:14942496-14942518 AGAAAATAGCAGAAGGAGGAAGG + Intergenic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1004505251 6:16241888-16241910 AAAAATTAGCAGAGCGTGGTAGG - Intronic
1004796217 6:19088418-19088440 AAAAATTAGTAGTAGGATGTGGG - Intergenic
1004947941 6:20636178-20636200 GAAAAATAGCAGAAGCAGGAAGG - Intronic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1006509557 6:34514778-34514800 AGAAACGAGCAGAAGGAGGTGGG + Intronic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1007667939 6:43527146-43527168 CAAAAATAGCAGAAGGAATTTGG - Intronic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1013333095 6:109126035-109126057 AAACATTAGCATAGGGAGGTAGG + Intronic
1013626960 6:111948109-111948131 AAAAATAGGCAGAGGGAGGTGGG + Intergenic
1013933264 6:115561802-115561824 CAAAATTATCTGAAGGCGGATGG - Intergenic
1014481422 6:121942750-121942772 GAAAATTTGCAGAAGGAAGCGGG - Intergenic
1014862858 6:126491684-126491706 AAAAATTAGCTGGAGGTGGTGGG - Intergenic
1017164621 6:151395967-151395989 CAAAATTAGCCGGACGTGGTAGG - Intergenic
1017296161 6:152797068-152797090 CAAATATAGTAGAAGGAGGGAGG - Intergenic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1019246175 6:170711641-170711663 AAAAATTAGCCGAATGTGGTGGG - Intergenic
1020600063 7:10263371-10263393 CAGATATCGCAGAAGGAGGTGGG - Intergenic
1021183109 7:17531785-17531807 CAAAAAGAGCAGAAGGAAATGGG + Intergenic
1022047884 7:26637864-26637886 CAAAATCAGCAGTAGGATCTCGG + Intronic
1023622199 7:42085346-42085368 CAAAACTAGCAGAAGCAGGTAGG + Intronic
1025946375 7:66108005-66108027 CAGAATTAGAAGAAGTAAGTTGG + Intronic
1026431002 7:70347236-70347258 AGAATTGAGCAGAAGGAGGTGGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026833162 7:73622338-73622360 AAAAATTAGCTGGAGGTGGTGGG + Intronic
1027589440 7:80099217-80099239 CAGAATTTGCAGAAGCAGCTGGG + Intergenic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1028432231 7:90760910-90760932 TAAAATTAGCAGATGTTGGTGGG - Intronic
1029150122 7:98474366-98474388 AAAAATTAGCAGAGCGTGGTGGG + Intergenic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031243969 7:119283004-119283026 CAAATTTGGCAGAAGAGGGTGGG + Intergenic
1032561182 7:132894465-132894487 CAAAAGTAGGAGAAGCAGCTAGG - Intronic
1033274542 7:139961461-139961483 CATAATGAGCTGGAGGAGGTGGG - Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1035501946 8:96557-96579 AAAAATTAGCCGAATGTGGTGGG + Intergenic
1035513774 8:213779-213801 AAAAATTAGCAAAAGTAGTTTGG - Intergenic
1037087743 8:14873714-14873736 CAAAATCAGTGGAAGGAGCTGGG - Intronic
1037750221 8:21676741-21676763 AAAAATTAGCTGAATGTGGTGGG + Intergenic
1040621697 8:49099157-49099179 CAATATTAGTAGAAGAAAGTAGG + Intergenic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1041499365 8:58523180-58523202 CAAACTTAGGAGAGGGATGTGGG - Intergenic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1046525595 8:115378461-115378483 CAAAATTAAGTGAAGGATGTGGG + Intergenic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1047221710 8:122923996-122924018 CAAAATTGGCAGAATCAGTTAGG + Intronic
1047850457 8:128851766-128851788 TAAAAGTAGAAGAGGGAGGTAGG + Intergenic
1048338025 8:133517500-133517522 CAAAATTAGCCAAAGTGGGTTGG - Intronic
1048897040 8:139001384-139001406 GCAAATTATCAGAAGGAAGTTGG + Intergenic
1051609356 9:18946122-18946144 CAAAATTAGCTGGATGTGGTGGG + Intronic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1055119185 9:72638509-72638531 CAAAATAAGCAGCAGGAAGGGGG - Intronic
1055679566 9:78701326-78701348 GAAGTTTAGCAGAAGGATGTAGG + Intergenic
1056131577 9:83592481-83592503 CAAAATTAGTAGAAGTAGGCCGG + Intergenic
1056645291 9:88406441-88406463 AAAAATTAGCTGAGGGTGGTTGG - Intronic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059979649 9:119756972-119756994 CAAAATTATCAGAAGAAAGGAGG - Intergenic
1061062918 9:128259626-128259648 CACACTTAGCAGATGGTGGTTGG - Intronic
1061437205 9:130571847-130571869 AAAAATTAGCAGATCGTGGTGGG - Intergenic
1062189060 9:135237985-135238007 CAAAATAATCAGCAGGTGGTGGG - Intergenic
1062506271 9:136878735-136878757 AAAACTTAGCTGAATGAGGTGGG + Intronic
1203606377 Un_KI270748v1:60853-60875 AAAAATTAGCCGAATGTGGTGGG - Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187068476 X:15864457-15864479 CAAAAGGAACACAAGGAGGTTGG + Intergenic
1187363584 X:18649344-18649366 GAAAACTAGGAGAATGAGGTGGG - Intronic
1189948149 X:46201784-46201806 CAAGATCAACAGAAGGAAGTTGG - Intergenic
1190061863 X:47216806-47216828 TAAAATGATCAGAAGGAGGTGGG - Intergenic
1190795193 X:53734467-53734489 CAAAGTTAGCAGCAGGAACTGGG - Intergenic
1192776480 X:74250881-74250903 AAAAATTAGCAGGGGGTGGTAGG + Intergenic
1193443541 X:81571395-81571417 CAAAATTAGTAGAAGGAAAGGGG + Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195343272 X:103925453-103925475 CAAAAATGGCAGAAGGAGTTGGG + Intronic
1195363722 X:104108014-104108036 CAAAAATGGCAGAAGGAGTTGGG - Intronic
1195473548 X:105260057-105260079 CAAAGTCACCTGAAGGAGGTGGG + Intronic
1196267485 X:113667429-113667451 CATTATTAGCAAAAGGAGGGTGG + Intergenic
1196636463 X:118008362-118008384 CAAAATAAGCAGAACTAGCTTGG + Intronic
1197662089 X:129185218-129185240 CAAAATAAGCAGAAGACAGTGGG + Intergenic
1198149254 X:133892190-133892212 CAAAGACAGCAGAAGGAAGTTGG - Intronic
1198185961 X:134254336-134254358 TCAAATTATCAGGAGGAGGTAGG - Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200611645 Y:5332102-5332124 CAAAATTAGCAGGGCGTGGTTGG + Intronic
1201437900 Y:13979192-13979214 CAAATCAGGCAGAAGGAGGTGGG - Intergenic
1201618165 Y:15924725-15924747 AAAAATTAGCCGAGGGCGGTGGG + Intergenic
1202367216 Y:24173772-24173794 CACACTTAGCAGATGGTGGTTGG + Intergenic
1202373217 Y:24211914-24211936 CACACTTAGCAGATGGTGGTTGG - Intergenic
1202388527 Y:24347273-24347295 AAAAATTAGCCGAATGTGGTGGG - Intergenic
1202482260 Y:25322855-25322877 AAAAATTAGCCGAATGTGGTGGG + Intergenic
1202497565 Y:25458206-25458228 CACACTTAGCAGATGGTGGTTGG + Intergenic
1202503565 Y:25496351-25496373 CACACTTAGCAGATGGTGGTTGG - Intergenic