ID: 917793676

View in Genome Browser
Species Human (GRCh38)
Location 1:178516242-178516264
Sequence CTGCTTTGCAACTTGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917793676_917793683 30 Left 917793676 1:178516242-178516264 CCCCTGAGCAAGTTGCAAAGCAG 0: 1
1: 0
2: 0
3: 19
4: 202
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917793676 Original CRISPR CTGCTTTGCAACTTGCTCAG GGG (reversed) Intronic
901586883 1:10303250-10303272 ATGGTTTGCAACTTGCTGGGAGG - Intronic
902452510 1:16506160-16506182 CTGCTTTGTAGATTGCTCAATGG - Intergenic
903323750 1:22557427-22557449 CTGCTCTGCTGCTTGCTTAGTGG + Intergenic
906879368 1:49574010-49574032 TTGCTTAGCAACTGCCTCAGGGG - Intronic
907780007 1:57558306-57558328 TTGCTTGGCAACTGCCTCAGGGG - Intronic
908384139 1:63624559-63624581 TTGCTCTGCAAATTCCTCAGTGG + Intronic
909194481 1:72600096-72600118 CTGCTTTGCAAATTGCAAAGTGG + Intergenic
911053355 1:93691110-93691132 CTGCTATGTAATTTGCTCAGTGG - Intronic
911982207 1:104581743-104581765 CTGCTTGGCAACTGCCTCAAGGG + Intergenic
912232076 1:107806050-107806072 CTGCTTTGTAACTTGGCCAAAGG - Intronic
912698210 1:111856840-111856862 CTGCTTAGCTGCTTGCCCAGAGG - Intronic
914096105 1:144545554-144545576 CTGCTTTGTAGATTGCTCAGTGG - Intergenic
914302416 1:146388408-146388430 CTGCTTTGTAGATTGCTCAGTGG + Intergenic
914517322 1:148385004-148385026 CTGCTTTGTAGATTGCTCAATGG - Intergenic
915556240 1:156662319-156662341 CTGCTTTGCAGCATGCAGAGCGG - Intergenic
916356003 1:163909054-163909076 CTGCTCTGAAACTTGGTCATAGG - Intergenic
916416025 1:164592654-164592676 CTGCTTTTCAACTTACTGTGTGG - Intronic
917052780 1:170942311-170942333 TTGCTTGGCAACTGCCTCAGGGG + Intronic
917713707 1:177712449-177712471 CTGCTGTGCAAGGTTCTCAGGGG - Intergenic
917793676 1:178516242-178516264 CTGCTTTGCAACTTGCTCAGGGG - Intronic
917952319 1:180052136-180052158 CTGCTTCTGCACTTGCTCAGTGG - Intronic
918146214 1:181758285-181758307 CTGCACTGCATTTTGCTCAGTGG - Intronic
1064577482 10:16760891-16760913 CTGCTATGCAAATTTCTCAAGGG + Intronic
1064678496 10:17785688-17785710 TTGTTTTGCAATGTGCTCAGGGG + Intronic
1067579647 10:47434116-47434138 CTGCTTTGGAACATCCTCTGTGG + Intergenic
1069191807 10:65501243-65501265 CTGTTTTGCAAACTGCTCACTGG - Intergenic
1069254708 10:66318131-66318153 TTGCTTTGCAGCTGGCCCAGTGG + Intronic
1069842923 10:71351214-71351236 CTGCTTTTCACCTTGCTGTGAGG - Intronic
1069915110 10:71782562-71782584 CTCCTTGGCAGCTTGCTCTGGGG - Intronic
1071378068 10:85030948-85030970 TTGCCTTGCAACTACCTCAGTGG - Intergenic
1071943106 10:90610245-90610267 TTGCTTGGCAACTGCCTCAGGGG + Intergenic
1072605986 10:96983135-96983157 CTGCTCAGCATCTTTCTCAGAGG - Exonic
1074529198 10:114285575-114285597 CTGCTTTGCCTTTTGCACAGAGG - Intronic
1075899104 10:126024504-126024526 TTGCTTTACACCTTGCTCACTGG - Intronic
1076122824 10:127949980-127950002 TTGCCTGGCAACTGGCTCAGGGG - Intronic
1079752527 11:24217261-24217283 CTGCTTTGGCTCATGCTCAGTGG - Intergenic
1080274796 11:30491677-30491699 CATCTTTACCACTTGCTCAGTGG - Intronic
1081617961 11:44601589-44601611 CTGCCCTGCAACTGGCGCAGTGG + Intronic
1082599579 11:55133045-55133067 ATATCTTGCAACTTGCTCAGAGG + Intergenic
1085693491 11:78684339-78684361 CTGCTTTGCAGGATGCTCTGAGG + Intronic
1085935332 11:81134880-81134902 CTTCTTTGCTACTAGCACAGTGG + Intergenic
1087916834 11:103820775-103820797 CTGCTTTGGCACATGCTCAGTGG + Intergenic
1088251563 11:107865492-107865514 ATGCTTTGCAAATTGCTCTCAGG + Intronic
1089673629 11:120074154-120074176 CTGAGTTGCAGCTTTCTCAGTGG - Intergenic
1090081515 11:123616523-123616545 ATGCTATACAATTTGCTCAGGGG - Intronic
1090700756 11:129293436-129293458 CTGCTTTGAAACTTGGGCAATGG + Intergenic
1091545831 12:1500746-1500768 CTGCTTGGAAACTTGCTGGGTGG + Intergenic
1092005388 12:5064988-5065010 CTGCTTTGCCACTTACTAACTGG + Intergenic
1093762019 12:22921359-22921381 CTGCTATCCCTCTTGCTCAGAGG + Intergenic
1095519803 12:43050121-43050143 CTGCCTGGCAAATTGCTCACTGG + Intergenic
1095707491 12:45253327-45253349 CTTCTCTGCAACTGGATCAGTGG - Intronic
1101382995 12:104230809-104230831 CTGATTTGCATAGTGCTCAGTGG + Intronic
1102291662 12:111705781-111705803 CTGCTTTGCCACTCGCTCACTGG - Exonic
1104278569 12:127353103-127353125 CTACTTTGCCTCTTCCTCAGAGG + Intergenic
1105506088 13:21010996-21011018 CTGGTTTGCAAACTGCTCATTGG + Intronic
1106083783 13:26522377-26522399 CTGGTTTGCAAACTGCTCACTGG + Intergenic
1106464434 13:30000015-30000037 CGGCTTGGCGTCTTGCTCAGGGG - Intergenic
1106599791 13:31177722-31177744 TGGCTTTGCATTTTGCTCAGAGG - Intergenic
1107490142 13:40873868-40873890 TTGCCTGGCAACTGGCTCAGGGG - Intergenic
1108026928 13:46187852-46187874 CTACTGTGCAAGTTACTCAGTGG + Intronic
1111340737 13:86882416-86882438 CTGCTTTGCATAGGGCTCAGGGG - Intergenic
1112630354 13:101154523-101154545 CTCTGTTGCACCTTGCTCAGGGG + Intronic
1113385487 13:109844026-109844048 CTTCTTCGCAACTTGCATAGAGG + Intergenic
1114758580 14:25286212-25286234 CTGCCTGGCAACTGCCTCAGGGG + Intergenic
1115038674 14:28892648-28892670 CTGGTTTGCAAATTGTTCACTGG + Intergenic
1115077895 14:29413900-29413922 CTGCTTTGGCTCATGCTCAGAGG - Intergenic
1116745594 14:48814547-48814569 CTGCTCTGCAACTTGGACTGAGG + Intergenic
1117541850 14:56755164-56755186 TTGTTTGGCTACTTGCTCAGAGG - Intergenic
1120337482 14:83175276-83175298 CTGGTTTACAACTTGTCCAGTGG + Intergenic
1125085346 15:35723333-35723355 ATACTTTGCAACATGCTAAGTGG + Intergenic
1127639634 15:60904053-60904075 CTGCTCTGCAAATTCCTCAAGGG - Intronic
1128861682 15:71079515-71079537 CTGCCTTCCAACTGGCTCTGGGG + Intergenic
1131586396 15:93699193-93699215 CTGGTTTGTAATTTTCTCAGTGG - Intergenic
1133419876 16:5637190-5637212 CTGATTTGCTTCTTTCTCAGCGG - Intergenic
1133522588 16:6573671-6573693 CTGCTGTGTGACATGCTCAGGGG + Intronic
1135202928 16:20454523-20454545 TTGCTTGGCAACTGCCTCAGGGG - Intronic
1135216172 16:20573343-20573365 TTGCTTGGCAACTGCCTCAGGGG + Intronic
1137267651 16:46882421-46882443 GTGCTTTGCAAATTGTACAGTGG + Intergenic
1139265492 16:65634612-65634634 ATCCCTTGCAGCTTGCTCAGAGG - Intergenic
1139283934 16:65793900-65793922 CTGCTCTGCACCAAGCTCAGTGG + Intergenic
1140583213 16:76255277-76255299 CTGCTTTGGCTCTTGCTCGGTGG + Intergenic
1140724607 16:77800717-77800739 CTGCTTTGTAACCTGCACTGGGG - Intronic
1140927915 16:79600522-79600544 CTGCCTTGCACTTTGCACAGAGG - Exonic
1143906963 17:10216599-10216621 CAGCTTTGCAAATGGCACAGAGG - Intergenic
1144213329 17:13033568-13033590 CTGCATTAGAATTTGCTCAGAGG + Intergenic
1147527491 17:41240088-41240110 CTGCTTTGGCTCATGCTCAGTGG - Intronic
1152297979 17:79479428-79479450 CTGCATTGCTCCTTGCTCTGAGG + Intronic
1155061659 18:22233967-22233989 CTGTTTAGTAACTTGCTGAGTGG + Intergenic
1156384154 18:36591040-36591062 AGGCTTGGCAACTTCCTCAGTGG - Intronic
1157438295 18:47689776-47689798 CTGCTGTGAAACTTGCGCAGTGG - Intergenic
1159746862 18:72247248-72247270 CTGGTTTGCAAACTGCTCACTGG - Intergenic
1160088725 18:75805521-75805543 CTGCTTTGCGATTAGCTCATAGG + Intergenic
1163019204 19:14473644-14473666 CTGGTGTGCAACACGCTCAGCGG - Exonic
1164117637 19:22237603-22237625 TTGCCTGGCAACTTTCTCAGGGG + Intergenic
1164620711 19:29694658-29694680 CTGTTTTGTAACTTCCCCAGGGG - Intergenic
1165566128 19:36729885-36729907 CTGGTTTGTAACTTGGCCAGAGG + Intronic
1167784643 19:51627309-51627331 CTGCTGGGCAACTTGCTCCAGGG + Intronic
925197487 2:1937963-1937985 CTGCCTTGCCACTTGATCACGGG - Intronic
926232787 2:11017695-11017717 CTGTTTTGCCCCTTGCCCAGGGG + Intergenic
928477199 2:31640733-31640755 CTGCTTTGTAACTTGGCCAAAGG - Intergenic
929049165 2:37820119-37820141 CTCAACTGCAACTTGCTCAGGGG - Intergenic
929209587 2:39340457-39340479 CTGGTCAGCAACTGGCTCAGTGG - Intronic
932939845 2:76150994-76151016 CTTCTTTGCTATTTGCTCAGTGG + Intergenic
934940616 2:98499054-98499076 CTGCTTTCCTAGTTCCTCAGTGG - Intronic
935117622 2:100150465-100150487 CTGCTGTGTAACTTGCTCTTTGG + Intergenic
935842431 2:107128099-107128121 CTGCTTTACAATTTGCTGAAAGG - Intergenic
936385622 2:112025704-112025726 CTGCTTTGCTCCTGGCTCTGAGG - Intronic
937186825 2:120051665-120051687 CTGCTTTGGCTCTTGCTCAGTGG + Intronic
937800004 2:126072258-126072280 CTGCCTGGCAACTGCCTCAGGGG - Intergenic
942703646 2:178742637-178742659 CTGCTTTGTTTCTTGCTCAGTGG - Intronic
943562264 2:189477924-189477946 CTGCTTTACAAATTGAGCAGAGG + Intergenic
946790605 2:223297261-223297283 TTGCTTGGCAACTGTCTCAGAGG - Intergenic
947857410 2:233333506-233333528 CTGCTCTGCAGCTTTCTGAGTGG - Intronic
948797040 2:240410768-240410790 CTGCTTTGCCGCTTGCCCAGGGG - Intergenic
1171078961 20:22158312-22158334 CTGCTTTGTAGTCTGCTCAGGGG - Intergenic
1173880453 20:46407569-46407591 CTGCTTTGCAGACTGCGCAGTGG - Intronic
1175121049 20:56716714-56716736 CTGCTTTGCAAGCTCCACAGAGG + Intergenic
1175881665 20:62262896-62262918 CTTCTTTGCACCCTGCTCTGTGG + Intronic
1176358877 21:5975936-5975958 CTGCTCTGCCACTTGCTCCCTGG - Intergenic
1176963380 21:15185146-15185168 CTGCTTTGCAGCATGATCAGAGG + Intergenic
1179089282 21:38249208-38249230 TTGTTTTTCAAATTGCTCAGTGG - Intronic
1179764641 21:43562614-43562636 CTGCTCTGCCACTTGCTCCCTGG + Intronic
1181379131 22:22485827-22485849 CTGCTGGGCACCTTGGTCAGGGG + Exonic
1181883222 22:25998186-25998208 CTGCATTGTAACTTGCACTGTGG + Intronic
1184576095 22:45367535-45367557 CTGCTGTGTAACTTGGTCAAAGG - Intronic
1184733026 22:46381416-46381438 CAGCTTTGCAACCTGCTCGGTGG - Intronic
951237366 3:20251425-20251447 CTTCTTAGCAACTTGTTAAGTGG - Intergenic
951982204 3:28577208-28577230 CTACTTTACAATTTTCTCAGCGG - Intergenic
954511939 3:51132991-51133013 CTGCCTGGCAACTGCCTCAGGGG - Intronic
955149128 3:56349499-56349521 CTGCTTTGGAGTTTGCTCTGAGG - Intronic
955208977 3:56923411-56923433 CTGCTTTTCAATTTGCTAGGAGG - Intronic
955814905 3:62831984-62832006 CTGCTTAGCATCTTGACCAGAGG - Intronic
957524827 3:81366837-81366859 CTGGTTTGCAAATTGTTCAAGGG + Intergenic
959112147 3:102134640-102134662 CTAATTTCCAACTTCCTCAGTGG + Intronic
959175526 3:102904702-102904724 CTGCTTTGCATAGGGCTCAGGGG + Intergenic
960755684 3:121009447-121009469 CTGCTTGGATCCTTGCTCAGTGG + Intronic
960791136 3:121432478-121432500 CTGGTTTATAACTTTCTCAGGGG - Intronic
961411376 3:126723360-126723382 CTGCTTAGCAAAGTACTCAGAGG - Intronic
962204720 3:133425434-133425456 ATCCCTTTCAACTTGCTCAGTGG + Intronic
968283134 3:197492087-197492109 CTGCTTTGCACTTTGGGCAGAGG + Intergenic
968871261 4:3243754-3243776 CTGCTTTGCACCGTGGTCAGAGG + Exonic
969294046 4:6258902-6258924 TTGCTTTGGAACTTGCACAGCGG - Intergenic
970796557 4:19920292-19920314 CTGCTTTGGCTCATGCTCAGTGG - Intergenic
972895581 4:43615974-43615996 CTGCTGTGCTAGTTGGTCAGAGG - Intergenic
974023634 4:56712796-56712818 CTGCTTTGGCTCATGCTCAGTGG - Intergenic
974347025 4:60695996-60696018 CTGCTTTGGCTCATGCTCAGTGG - Intergenic
975418914 4:74139358-74139380 CTGCTGTGCAACTTGGCCAAAGG - Intronic
977526997 4:98157774-98157796 CTGCTCTTCATCTTGCCCAGAGG + Intergenic
977860916 4:101958794-101958816 CTGCTTTGCTGCTAGCACAGTGG + Intronic
980194632 4:129572474-129572496 CTGTTTTGCAGGTGGCTCAGAGG + Intergenic
980206161 4:129721457-129721479 CTGCTTTGGGTCATGCTCAGTGG + Intergenic
981149906 4:141368679-141368701 CTGCTTTGGCTCATGCTCAGTGG + Intergenic
984015267 4:174417862-174417884 CTGCTTTGGCTCATGCTCAGTGG + Intergenic
984061387 4:174992299-174992321 TTGCTTGGCAACTGCCTCAGAGG + Intergenic
987464462 5:18255130-18255152 CTGCTTTCAAAATTGCACAGGGG - Intergenic
988268726 5:28986420-28986442 CTGCTTAGCACCTGCCTCAGGGG + Intergenic
991192915 5:63896869-63896891 CTCCTTTGCAATTTGTTCAGAGG + Intergenic
996429825 5:123361405-123361427 CTGCTATGCACCTTGCACAATGG - Intronic
996981149 5:129496638-129496660 CAGCTGTGCAGCTTTCTCAGTGG + Intronic
997890429 5:137671636-137671658 CTGCCTTGCAACTTGTTGTGAGG + Intronic
998645407 5:144055884-144055906 CTGCTTTGGCTCATGCTCAGTGG + Intergenic
1000806951 5:165807001-165807023 CTGCAATGCAAGCTGCTCAGGGG - Intergenic
1001425119 5:171617807-171617829 CTGCTCTGAAGCTTGCTCAAGGG + Intergenic
1002972130 6:2034611-2034633 CTGGGTTGCAACTGGCTCACAGG + Intronic
1003118945 6:3304596-3304618 CTTCTATCCAACTCGCTCAGTGG - Intronic
1003480734 6:6530212-6530234 CTGCTCTGTCACTTGCTCTGAGG - Intergenic
1003876684 6:10443764-10443786 CTTCCTTGCAACTTGCTGAATGG + Intergenic
1004349599 6:14879593-14879615 GTAGTTTGCAACTTGTTCAGGGG - Intergenic
1006412004 6:33879181-33879203 CTGCTGGGAAACCTGCTCAGGGG + Intergenic
1007244442 6:40450447-40450469 CTCCCTTGCAATGTGCTCAGGGG - Intronic
1008968856 6:57343395-57343417 TTGCTTTGCAACTTGTTAATAGG - Intronic
1009157838 6:60245214-60245236 TTGCTTTGCAACTTGTTAATAGG - Intergenic
1009453220 6:63825417-63825439 CTGCTTGGCCTCTTGCCCAGAGG - Intronic
1010323249 6:74537971-74537993 CTGCCTGGCAACTGCCTCAGGGG - Intergenic
1012921122 6:105221970-105221992 TTGCCTGGCAACTGGCTCAGGGG + Intergenic
1013579724 6:111521401-111521423 ATTTTTTGAAACTTGCTCAGTGG + Intergenic
1014063645 6:117101240-117101262 CTGCTTTGGCTCTTGCTCGGTGG + Intergenic
1015402351 6:132800403-132800425 CTCCTTTACAACTTGCCCACTGG - Intergenic
1015793787 6:136990108-136990130 ATGCTTTCCCACTCGCTCAGCGG + Intergenic
1016057181 6:139590696-139590718 GTGCTTTGCAACTGGCGGAGAGG + Intergenic
1019782878 7:2954653-2954675 CTGGGTTGCAAGCTGCTCAGAGG + Intronic
1024902132 7:54331734-54331756 CTGCTTTCCAGCTTGCTAACTGG - Intergenic
1026440968 7:70443802-70443824 CTGCTCTGCTACTTACTCACAGG - Intronic
1026607361 7:71827344-71827366 CTGCTGTGCTCCTGGCTCAGAGG - Intronic
1028281227 7:88931047-88931069 CTACTTTGTCACTGGCTCAGGGG + Intronic
1028543520 7:91972223-91972245 CTGCTTTGTAACTTGGCCAAAGG - Intronic
1028560358 7:92168416-92168438 CTGCTTTGTAACTTGGCCAAAGG + Intronic
1029804600 7:102983171-102983193 TTGCTTGGCAACTGCCTCAGTGG + Intronic
1030356264 7:108546277-108546299 CTGCTCTGCAAGTTCCTAAGAGG - Intronic
1031527008 7:122834457-122834479 CTGCTTCGGATCTCGCTCAGTGG - Intronic
1032902024 7:136320859-136320881 CTGTTTTGCACCTTGCTGATAGG + Intergenic
1033827264 7:145206806-145206828 CTTCTTGGAAACTTGCTCACTGG - Intergenic
1034736162 7:153431316-153431338 CTGATTTGCATAGTGCTCAGGGG - Intergenic
1035589598 8:802483-802505 CTGCTTCTCAACTTGCTGGGTGG + Intergenic
1038533061 8:28334336-28334358 CTGTTTTGGAACTTGCTCTGAGG - Intronic
1038941025 8:32306094-32306116 CTGTTTTTAAACTTGCTGAGGGG - Intronic
1040097466 8:43459888-43459910 CTGCTTCGCCTCATGCTCAGTGG + Intergenic
1041971816 8:63752057-63752079 CTGCTGTGGAACATGGTCAGAGG + Intergenic
1042178340 8:66059763-66059785 CTGCTTTGCCATTTGCTGTGTGG + Intronic
1042344206 8:67711008-67711030 CATCTTTGCATCTTGCTCAGAGG + Intronic
1047686575 8:127311143-127311165 ATGCTGTGCAAATTGCTAAGAGG + Intergenic
1048399501 8:134051223-134051245 CTGCTTTCCAACTTGCTTCTGGG - Intergenic
1049161936 8:141103399-141103421 CTGCAGTGCAAGTGGCTCAGAGG + Intergenic
1051109481 9:13619542-13619564 CTGCTTTGAGTCTTGCTCTGGGG + Intergenic
1052584179 9:30403323-30403345 CTGCTTTGCAAACTACTCAAAGG - Intergenic
1054968473 9:71057156-71057178 CTGCTTTTCCACTTGCCCAGGGG + Intronic
1058367112 9:104221284-104221306 CTGCTTTGGCTCATGCTCAGTGG + Intergenic
1059667717 9:116464763-116464785 CTGCTTTGAAGCTTGCTCTCTGG + Intronic
1060054336 9:120400848-120400870 CTGCTCACAAACTTGCTCAGTGG + Exonic
1060994303 9:127867560-127867582 CTCCTCTGCATCTTGCTCTGTGG - Exonic
1185636442 X:1555411-1555433 CTGCTATGCATATTCCTCAGTGG - Intergenic
1187604550 X:20869565-20869587 TTGCTTGGCAACTGCCTCAGGGG - Intergenic
1188686650 X:33077564-33077586 CTGCTTTGCAACTGTTTGAGTGG + Intronic
1188822196 X:34789331-34789353 CTTCTTTGGAACTGGCTCATAGG - Intergenic
1194385941 X:93255369-93255391 TTGCTTGGCAACTGCCTCAGTGG + Intergenic
1195080840 X:101368503-101368525 ATGTTATGCAACTTGCTCATGGG - Intronic
1195320161 X:103715211-103715233 CTACTTTGCCACTTACTAAGAGG + Intronic
1197084517 X:122456002-122456024 TTGCTTGGCAACTGCCTCAGGGG + Intergenic
1197245432 X:124161815-124161837 TTGCTTGGCAACTGCCTCAGGGG + Intronic
1197426058 X:126298111-126298133 TTGCCTTGCAACTGCCTCAGGGG + Intergenic
1197909123 X:131461753-131461775 CTGCTTTGGCTCATGCTCAGTGG - Intergenic
1198783363 X:140260294-140260316 TTGCTTGGCAACTGCCTCAGGGG + Intergenic