ID: 917793677

View in Genome Browser
Species Human (GRCh38)
Location 1:178516243-178516265
Sequence CCTGCTTTGCAACTTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917793677_917793683 29 Left 917793677 1:178516243-178516265 CCCTGAGCAAGTTGCAAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917793677 Original CRISPR CCTGCTTTGCAACTTGCTCA GGG (reversed) Intronic
902429241 1:16350033-16350055 CCTGCTCTGAATCTTACTCAGGG + Intronic
905852057 1:41281841-41281863 CCTGCATTGCAGCTAGTTCAGGG + Intergenic
906627639 1:47338334-47338356 TCTGCTCTGCAAATTGCTCCTGG + Intronic
907780008 1:57558307-57558329 CTTGCTTGGCAACTGCCTCAGGG - Intronic
908837745 1:68245066-68245088 CAGGCTTAGTAACTTGCTCAAGG - Intergenic
911982206 1:104581742-104581764 TCTGCTTGGCAACTGCCTCAAGG + Intergenic
913689600 1:121266673-121266695 CAGGTTTTGAAACTTGCTCAGGG + Intronic
914147998 1:145013599-145013621 CAGGTTTTGAAACTTGCTCAGGG - Intronic
917052779 1:170942310-170942332 CTTGCTTGGCAACTGCCTCAGGG + Intronic
917793677 1:178516243-178516265 CCTGCTTTGCAACTTGCTCAGGG - Intronic
918814787 1:189168766-189168788 CTTGCCTGGCAACTTCCTCAGGG - Intergenic
919742603 1:200989956-200989978 CCTGCTAGACAACTTCCTCAAGG - Exonic
920476923 1:206285147-206285169 CAGGTTTTGAAACTTGCTCAGGG + Intronic
921194689 1:212743985-212744007 CCTGATTTGGAACTCTCTCAGGG + Intronic
922888184 1:229036693-229036715 CCTTCATTGCAACTTTCTCAGGG + Intergenic
924660560 1:246012700-246012722 CCTGCTTTGCTGTTTCCTCAAGG - Intronic
1063765594 10:9136697-9136719 CCTCATTTACAACTTGGTCATGG - Intergenic
1064577481 10:16760890-16760912 TCTGCTATGCAAATTTCTCAAGG + Intronic
1064784073 10:18874908-18874930 CTTGCTTGGCAACTGCCTCAAGG - Intergenic
1065417269 10:25502126-25502148 CCTGCTTTGGAACTAGCCCTGGG - Intronic
1065937861 10:30536766-30536788 CCTGCTTTGCAGCTTGCCCCAGG - Intergenic
1066447013 10:35492601-35492623 GCTGGATTGCATCTTGCTCATGG + Intronic
1066698780 10:38104236-38104258 CCTTCCTTGAAACTTTCTCAGGG - Intronic
1066993867 10:42543982-42544004 CCTGCCTTGGAACTTTCTCAGGG + Intergenic
1068852007 10:61753412-61753434 CTTACCTTGCAACTTCCTCAGGG - Intronic
1070662653 10:78318625-78318647 CCTGCCTTGCAGCTAGCACATGG - Intergenic
1070764371 10:79048108-79048130 CCTCCTGTGCACCCTGCTCAGGG - Intergenic
1071595280 10:86917850-86917872 CCTGCTTGGCAACATGCTATGGG - Intronic
1075113825 10:119609308-119609330 CCTGCTTTGGAACTAGGTCTAGG + Intergenic
1076122825 10:127949981-127950003 CTTGCCTGGCAACTGGCTCAGGG - Intronic
1079913670 11:26341676-26341698 CTTGCTCTGCAACTTGCAGACGG - Intronic
1082298231 11:50471420-50471442 CATTCTTTCCAACTTGCTGAAGG + Intergenic
1082814640 11:57499863-57499885 CCTGCTGTGCAACTTGGCCCAGG - Intronic
1084576739 11:69993501-69993523 CCTGCTTGCCAAATTGATCAAGG + Intergenic
1085455080 11:76661034-76661056 CCTGCATAGCAACGTGCTGATGG - Exonic
1089189544 11:116644194-116644216 CCTGCTTTGTAACCTTCTCTCGG - Intergenic
1089855144 11:121537075-121537097 CATGCTTTGGCCCTTGCTCAAGG - Intronic
1089925598 11:122254347-122254369 CCTGCTTTGCAACTAACTTTCGG + Intergenic
1090081516 11:123616524-123616546 CATGCTATACAATTTGCTCAGGG - Intronic
1091103285 11:132895755-132895777 CTTGCTTGGCAACTGCCTCATGG - Intronic
1092271088 12:7023925-7023947 CCTGCATGGCAACTTCCTCAGGG - Intronic
1096199792 12:49673441-49673463 CCTGCTTTGCCACTGGCTTGGGG - Intronic
1097709757 12:62905025-62905047 CCAGCTCTGCCACTTACTCATGG + Intronic
1099445644 12:82748427-82748449 CCAGCTTGGCAACTTACTAATGG + Intronic
1101269453 12:103128334-103128356 CCTGCCCTGCACCTGGCTCAGGG + Intergenic
1102345996 12:112161806-112161828 CCTGCTTTAGAACTTGCTCCCGG - Exonic
1106464435 13:30000016-30000038 CCGGCTTGGCGTCTTGCTCAGGG - Intergenic
1107490143 13:40873869-40873891 CTTGCCTGGCAACTGGCTCAGGG - Intergenic
1110185021 13:72663837-72663859 CCTGCTTTGCAATTTGCATGAGG + Intergenic
1111517274 13:89350988-89351010 CCTGCTATGAAACTCGCTCTTGG + Intergenic
1112495484 13:99900597-99900619 CCTGCTAGGGGACTTGCTCAAGG + Intergenic
1112630353 13:101154522-101154544 CCTCTGTTGCACCTTGCTCAGGG + Intronic
1114758579 14:25286211-25286233 CCTGCCTGGCAACTGCCTCAGGG + Intergenic
1118045779 14:61969602-61969624 CCAGCTGTGCAATTTGATCATGG - Intergenic
1118143688 14:63113122-63113144 CCTGCCTTGCACCATGTTCACGG - Intergenic
1118819423 14:69335282-69335304 CCAGCTTTGTAACTTGCTTTTGG + Intronic
1120194691 14:81468806-81468828 CAAGCTAAGCAACTTGCTCAAGG - Intergenic
1120439582 14:84519903-84519925 ACAGCTCTGCAAATTGCTCAAGG + Intergenic
1124396035 15:29302744-29302766 CACGCCTTGCAAATTGCTCAAGG - Intronic
1126932592 15:53671484-53671506 CCTGCTTTGTACCAAGCTCATGG - Intronic
1127639635 15:60904054-60904076 ACTGCTCTGCAAATTCCTCAAGG - Intronic
1133782707 16:8952340-8952362 CCAGCTCTGCCACTTGCTCTGGG + Intronic
1135202929 16:20454524-20454546 CTTGCTTGGCAACTGCCTCAGGG - Intronic
1135216171 16:20573342-20573364 CTTGCTTGGCAACTGCCTCAGGG + Intronic
1135507728 16:23053182-23053204 CTTTCCTTGCAACTTGGTCATGG + Intergenic
1139546570 16:67652675-67652697 CCAGCTTTGCAGGTTGCACAAGG - Intronic
1145728819 17:27157249-27157271 CCTGACTTCCAACTTCCTCATGG - Intergenic
1146515387 17:33485274-33485296 TCTGCTTTGCACTTTACTCAGGG - Intronic
1155287630 18:24307374-24307396 CCTGCTTTGTAACTTTCTTAGGG + Intronic
1155557916 18:27042276-27042298 CCTGCTATGTGACTTGGTCAAGG - Intronic
1155902622 18:31410051-31410073 CCAGCTCTGCCACTTGCTTAAGG + Intronic
1156221653 18:35058931-35058953 CCTGCTTTGCCACTTAATAATGG + Intronic
1157765356 18:50292532-50292554 CCTGCTTTGATTCTTGCCCAAGG - Intergenic
1158155699 18:54423273-54423295 CCTGATTTGCATCTTGATGAAGG + Intergenic
1160781996 19:881792-881814 CCTGGTGTGCAACCTGCCCAGGG + Intronic
1164789071 19:30960640-30960662 CCAGCTCTGCCACTTACTCACGG - Intergenic
1166372565 19:42310323-42310345 CCTGCTCTGGGACTTGATCAGGG - Exonic
1167784642 19:51627308-51627330 CCTGCTGGGCAACTTGCTCCAGG + Intronic
1168106450 19:54168453-54168475 CCAGCTCTTCAACTTGCTCTCGG - Exonic
925197488 2:1937964-1937986 GCTGCCTTGCCACTTGATCACGG - Intronic
927448622 2:23187440-23187462 CTTCTTTTGCAACTTGCACAAGG - Intergenic
927673644 2:25089382-25089404 CCTGCCTTGAAACTTTCTGAAGG - Intronic
929049166 2:37820120-37820142 CCTCAACTGCAACTTGCTCAGGG - Intergenic
931190019 2:59991217-59991239 GCAGCTTTGCAACCTGATCATGG + Intergenic
931477409 2:62603311-62603333 CCTGGTTTCCAGCTTGCACAAGG + Intergenic
931639780 2:64371567-64371589 TCTGCTTTGGAACTTGGTGATGG - Intergenic
932097679 2:68866059-68866081 CCAGCTCTGGAAGTTGCTCATGG + Exonic
932800097 2:74734049-74734071 CCTGCCTTCCAACTTCCTCTAGG - Intergenic
936084290 2:109455997-109456019 CCTGCCCTGCAGCCTGCTCACGG + Intronic
937800005 2:126072259-126072281 CCTGCCTGGCAACTGCCTCAGGG - Intergenic
938132408 2:128728033-128728055 CCTGTTTTGCAACTCTCACAAGG - Intergenic
939758789 2:146148565-146148587 CCTGTTGACCAACTTGCTCAAGG - Intergenic
940476931 2:154174488-154174510 AATGCTTTCCAACTTGCTCATGG - Intronic
943909961 2:193551203-193551225 CCTGTCTTCCAACTTGCACAGGG + Intergenic
945715501 2:213353377-213353399 ACTGGTTTTCAAATTGCTCATGG - Intronic
946069463 2:217019300-217019322 CCTGATTTGGAAGTTTCTCATGG - Intergenic
948797041 2:240410769-240410791 CCTGCTTTGCCGCTTGCCCAGGG - Intergenic
948938230 2:241182320-241182342 CCTGCTTTGACACTTGCCTATGG + Intronic
1169092391 20:2869508-2869530 CCTGCTGTACAAACTGCTCAGGG - Intronic
1177819202 21:26012620-26012642 ACAGCTTTGTAACCTGCTCAAGG + Intronic
1179770213 21:43609735-43609757 GCTGCCTTCCAACATGCTCATGG - Intronic
1182012013 22:27009011-27009033 CCTTCTATGCAACTGGCTTAGGG - Intergenic
949984350 3:9528070-9528092 CCTTCATTGCAACTTGCTGAAGG - Intronic
953052191 3:39354671-39354693 TCTGCTCTGCAACATTCTCATGG + Intergenic
953275277 3:41489665-41489687 GCTGCTTTGCAATTTTTTCAAGG + Intronic
953669816 3:44952784-44952806 CCTTCTCTGCTACTTCCTCATGG + Intronic
954360817 3:50121913-50121935 CCTGCCTTGCAAGTTCCTGAGGG + Intergenic
954511940 3:51132992-51133014 CCTGCCTGGCAACTGCCTCAGGG - Intronic
957524826 3:81366836-81366858 TCTGGTTTGCAAATTGTTCAAGG + Intergenic
957552419 3:81723850-81723872 TCTGCTTTGCTTCCTGCTCACGG + Intronic
959175525 3:102904701-102904723 CCTGCTTTGCATAGGGCTCAGGG + Intergenic
961254867 3:125540876-125540898 GCTCCTTTGCAAGTTCCTCATGG - Intronic
963332852 3:143935060-143935082 TTTGCTTTGCAACTTCCTAAAGG - Intergenic
964692209 3:159462395-159462417 AGGGCTTTGCAACTTGCTAAGGG - Intronic
966445349 3:179996084-179996106 CTTGCTTGGCAACTACCTCAAGG - Intronic
969179406 4:5425382-5425404 CCAGCTTTGCCACTTTCTCTGGG - Intronic
972479779 4:39486341-39486363 CCTTCTTTGCCTCTTGGTCACGG - Intergenic
977523990 4:98122521-98122543 CCAACCTTGCAACTTGATCATGG + Intronic
980835750 4:138189747-138189769 CATGCTTTGCAACTCTATCATGG + Intronic
982950881 4:161694153-161694175 CTTGCTTTTCTACTTGCTTAAGG + Intronic
985868890 5:2538327-2538349 CCTCCTCTGCAGCCTGCTCAAGG + Intergenic
986269250 5:6217028-6217050 CCTGCTTTCCAAGTTGATCTTGG - Intergenic
987464463 5:18255131-18255153 CCTGCTTTCAAAATTGCACAGGG - Intergenic
988268725 5:28986419-28986441 CCTGCTTAGCACCTGCCTCAGGG + Intergenic
988982942 5:36589719-36589741 AAAGCTTTGCAACTTGCCCAAGG + Intergenic
989321704 5:40142504-40142526 CATGCTTTGTAACTTCCTCAGGG - Intergenic
990146952 5:52772302-52772324 CCTTCAGTGCAACTTGCTCCTGG + Intergenic
990534596 5:56707833-56707855 CCTGCTTCTAAACTTGCTAAAGG - Intergenic
990742939 5:58930751-58930773 ACTGCTTGGCAACCTTCTCATGG + Intergenic
993636728 5:90353198-90353220 TCTGATTTGCAACTGGCTAAGGG + Intergenic
995061918 5:107820368-107820390 CTTGATTTGCAACATGCCCATGG - Intergenic
997537705 5:134635393-134635415 CTTGCTTATCAAGTTGCTCAGGG - Intronic
998740985 5:145201416-145201438 CCTGCTCTGGAACTTACTAAGGG + Intergenic
998840866 5:146252131-146252153 CCTGATTAGAAACTAGCTCAAGG - Intronic
999205542 5:149845416-149845438 CCTGCTCTGCCACTTGCTTTTGG + Intronic
1000031362 5:157405025-157405047 CTTGCTTTGCTAGTTCCTCAAGG - Intronic
1000806952 5:165807002-165807024 CCTGCAATGCAAGCTGCTCAGGG - Intergenic
1001230770 5:169985901-169985923 CCTGTTTTGAACCATGCTCATGG - Exonic
1001425118 5:171617806-171617828 CCTGCTCTGAAGCTTGCTCAAGG + Intergenic
1002129416 5:177070986-177071008 GCTGCTTTGCATCTAGCTCTGGG - Intronic
1003758274 6:9147553-9147575 CTTGCTTGGCAACTGCCTCAGGG - Intergenic
1004888077 6:20071027-20071049 CCTGCTTTGGGAGTTTCTCAAGG - Intergenic
1005676764 6:28162810-28162832 CCAGCTTAGCCACTTGCCCAAGG - Intergenic
1006938630 6:37736465-37736487 CCCCATTTGCAACTGGCTCAAGG + Intergenic
1010323250 6:74537972-74537994 CCTGCCTGGCAACTGCCTCAGGG - Intergenic
1012730147 6:102871845-102871867 CTTGCCTGGCAACTTTCTCAAGG - Intergenic
1012921121 6:105221969-105221991 CTTGCCTGGCAACTGGCTCAGGG + Intergenic
1014523615 6:122474849-122474871 CCTGCTTTACATTTTTCTCAGGG - Intronic
1016936604 6:149452659-149452681 CCTGCTCAGGAAGTTGCTCAGGG + Exonic
1018588331 6:165387510-165387532 TCTGCTTCGCAACTTGCCTATGG + Intronic
1023855700 7:44182351-44182373 CCTGCTTGGCTACTGGCACAAGG - Intronic
1026141103 7:67707533-67707555 CTTACTTGGGAACTTGCTCATGG + Intergenic
1028935279 7:96457000-96457022 CCTGCTTAGCTGCTTGCTGAAGG + Intergenic
1030645919 7:112061456-112061478 CCTGGTTTGTATCTTGCTCCTGG - Intronic
1032905460 7:136359575-136359597 CCTGCTTCTGAACTTGCCCAAGG - Intergenic
1034756738 7:153628813-153628835 CCATCTTAGCATCTTGCTCAAGG + Intergenic
1036181584 8:6590412-6590434 CCTGCTTTGCTTTTTGTTCATGG - Intronic
1037080974 8:14785887-14785909 CCTGCTGTGCCACTTGCTTTTGG + Intronic
1038299255 8:26327002-26327024 CCTTCTTTGTAACTTGTTCCTGG - Intronic
1038941026 8:32306095-32306117 CCTGTTTTTAAACTTGCTGAGGG - Intronic
1040056336 8:43060812-43060834 CTTGCTTTTTAACTTGCTCATGG - Intronic
1043068318 8:75604650-75604672 AGTGCTTGGAAACTTGCTCAGGG - Intergenic
1045905423 8:107339254-107339276 TCTCCTTTGCAACATGCTAATGG + Intronic
1048318317 8:133378307-133378329 CCTGCTCATCACCTTGCTCATGG - Intergenic
1048399502 8:134051224-134051246 ACTGCTTTCCAACTTGCTTCTGG - Intergenic
1048558977 8:135511998-135512020 TCTGCTTTGCCATTTGTTCATGG + Intronic
1048811177 8:138287962-138287984 CCTTATTTGTAACATGCTCAAGG + Intronic
1054804867 9:69388008-69388030 CCTGCTTTTCATCTTGCAGAAGG - Intronic
1054968472 9:71057155-71057177 ACTGCTTTTCCACTTGCCCAGGG + Intronic
1057874503 9:98743541-98743563 GCTGCCTTGCCACTTCCTCAGGG + Intronic
1058268838 9:102943331-102943353 CCACCTCTGCAAGTTGCTCAAGG - Intergenic
1060392745 9:123291731-123291753 CCTGCTCTGCCACTTGGGCAAGG + Intergenic
1060489852 9:124074981-124075003 CCTGCTTTGCAGCTTTCAAAAGG - Intergenic
1061328140 9:129876327-129876349 ACTGCTTTCAAACTTGCTCAGGG - Intronic
1185609252 X:1384819-1384841 CCTGCTTTGCCACTTGCCTCTGG + Intergenic
1186785529 X:12953263-12953285 CCTGCTTTACTACATGCTGAAGG - Intergenic
1187017660 X:15346206-15346228 GCTGTTTTGCCACTTGCACATGG + Exonic
1187604551 X:20869566-20869588 CTTGCTTGGCAACTGCCTCAGGG - Intergenic
1189230561 X:39449401-39449423 CCTGTTTTGCAGTTTGCTCATGG - Intergenic
1190507219 X:51138122-51138144 CCGGCTATGTAACTTACTCATGG - Intergenic
1191671123 X:63749990-63750012 CCAGCTCTGCAACTTGTTCTAGG - Intronic
1194123225 X:89986074-89986096 CTTGCTTTGAAACTTGCTTCAGG - Intergenic
1195080841 X:101368504-101368526 GATGTTATGCAACTTGCTCATGG - Intronic
1196438634 X:115696827-115696849 CATCCTTTGCCACTTGCCCAGGG - Intergenic
1197084516 X:122456001-122456023 CTTGCTTGGCAACTGCCTCAGGG + Intergenic
1197245431 X:124161814-124161836 CTTGCTTGGCAACTGCCTCAGGG + Intronic
1197426057 X:126298110-126298132 CTTGCCTTGCAACTGCCTCAGGG + Intergenic
1198039292 X:132834028-132834050 CCTGCTATGTAACCTGCCCAAGG + Intronic
1198783362 X:140260293-140260315 CTTGCTTGGCAACTGCCTCAGGG + Intergenic
1199884458 X:152005882-152005904 CTTGCTTTGCGACTTCCTTAAGG - Intergenic
1200476085 Y:3643522-3643544 CTTGCTTTGAAACTTGCTTCAGG - Intergenic
1202258869 Y:22948637-22948659 CCTGGAGTGCAAGTTGCTCAGGG + Intergenic
1202411857 Y:24582395-24582417 CCTGGAGTGCAAGTTGCTCAGGG + Intergenic
1202458925 Y:25087677-25087699 CCTGGAGTGCAAGTTGCTCAGGG - Intergenic