ID: 917793679

View in Genome Browser
Species Human (GRCh38)
Location 1:178516244-178516266
Sequence TCCTGCTTTGCAACTTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917793679_917793683 28 Left 917793679 1:178516244-178516266 CCTGAGCAAGTTGCAAAGCAGGA 0: 1
1: 0
2: 0
3: 35
4: 339
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917793679 Original CRISPR TCCTGCTTTGCAACTTGCTC AGG (reversed) Intronic
900428116 1:2589697-2589719 TCCTGCTCTGCGACTTTCTCTGG + Exonic
901208757 1:7512670-7512692 TTTTGCTATGTAACTTGCTCTGG - Intronic
902605522 1:17567025-17567047 TCCTGCTTTGCACCCTGATCTGG + Intronic
904835396 1:33332322-33332344 TCCTGCTGTGGAAGTTTCTCAGG + Exonic
905295275 1:36950659-36950681 TCCTGCTGCACAACTTGCTTTGG + Intronic
905852055 1:41281840-41281862 TCCTGCATTGCAGCTAGTTCAGG + Intergenic
907373056 1:54015440-54015462 CCCTGCTGTGCAGCTTGCCCTGG + Intronic
907780009 1:57558308-57558330 TCTTGCTTGGCAACTGCCTCAGG - Intronic
909200431 1:72685249-72685271 TCCTGCTTTAAAACTTGCCTTGG - Intergenic
910704058 1:90107651-90107673 TCCTCCTTTGCCACTTGCCTGGG - Intergenic
911235338 1:95405956-95405978 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
911749606 1:101481302-101481324 TCCTGCTCTGAAACTTGTCCTGG + Intergenic
911816041 1:102352721-102352743 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
912668650 1:111605924-111605946 TCCTGCTGCTCAGCTTGCTCTGG - Intronic
915058931 1:153163556-153163578 TCTTGCTTTGAAACTTGCTTTGG - Intergenic
916650839 1:166832904-166832926 TCCTACTCTGAAACTTGCTTTGG + Intergenic
917052778 1:170942309-170942331 TCTTGCTTGGCAACTGCCTCAGG + Intronic
917098901 1:171426417-171426439 TCCTGCTCTGGAACTTGCTTCGG + Intergenic
917793679 1:178516244-178516266 TCCTGCTTTGCAACTTGCTCAGG - Intronic
918614715 1:186531506-186531528 TCCTGTTTTGCAACCTTCACTGG - Intergenic
918814788 1:189168767-189168789 TCTTGCCTGGCAACTTCCTCAGG - Intergenic
920080809 1:203371673-203371695 TTCTGCTCTGCAAGTTGCTGAGG + Intergenic
922888182 1:229036692-229036714 TCCTTCATTGCAACTTTCTCAGG + Intergenic
923367434 1:233276710-233276732 TTCTGCTTTGTAGCTTACTCTGG - Intronic
923495425 1:234520258-234520280 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
924930820 1:248730939-248730961 TCCTGCTCTGAAACTTGCCTCGG - Intronic
1063521167 10:6742638-6742660 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1063655147 10:7980830-7980852 GCCTGCTTTGCCACCTGCCCTGG - Intronic
1065417271 10:25502127-25502149 TCCTGCTTTGGAACTAGCCCTGG - Intronic
1066993865 10:42543981-42544003 GCCTGCCTTGGAACTTTCTCAGG + Intergenic
1067493878 10:46744045-46744067 TCTTGTTTTACTACTTGCTCTGG + Intergenic
1067600781 10:47596360-47596382 TCTTGTTTTACTACTTGCTCTGG - Intergenic
1067893932 10:50159825-50159847 TCCTGCTTTAAAACTTGCCTCGG + Intergenic
1067954913 10:50780439-50780461 TCCTGCTTTAAAACTTGCCTCGG - Intronic
1069118293 10:64535785-64535807 TCCTGCTTTGCAACTCACCTCGG - Intergenic
1069915112 10:71782564-71782586 TTCTCCTTGGCAGCTTGCTCTGG - Intronic
1071595282 10:86917851-86917873 GCCTGCTTGGCAACATGCTATGG - Intronic
1072520063 10:96223393-96223415 TCCTGCTCTGAAACTTGCCTTGG + Intronic
1073086419 10:100892714-100892736 ACCTACTTTGCAACAAGCTCTGG - Intergenic
1073321854 10:102620444-102620466 CCCTGCTTTGCCACATGCTGGGG - Intronic
1073532268 10:104243553-104243575 TCCTGCTCTGAAACTTGCCTCGG - Intronic
1073902586 10:108240967-108240989 TCTCGCTTTGAAACTTTCTCTGG - Intergenic
1076059348 10:127401359-127401381 TCCTGCTCTGAAACTTGCCTCGG - Intronic
1076122826 10:127949982-127950004 TCTTGCCTGGCAACTGGCTCAGG - Intronic
1076408877 10:130231803-130231825 TCCTGCTTTGCTAGTTGTTTGGG + Intergenic
1078281268 11:9903552-9903574 TCCTGCTCTGAAACTTGCCTCGG - Intronic
1079471930 11:20786678-20786700 TCCTGCTTTAAAACTTGCCTCGG - Intronic
1081063773 11:38513380-38513402 TCCTTCTTGCCTACTTGCTCTGG + Intergenic
1081323220 11:41716312-41716334 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
1082121176 11:48381609-48381631 TCCTGCTTTACAACTTCATAAGG - Intergenic
1082187675 11:49204309-49204331 TCCTGCTCTGAAACTTGCCTTGG + Intronic
1082252668 11:49999033-49999055 TCCTGCTTTACAACTTTGTAAGG + Intergenic
1082555169 11:54555856-54555878 TCCTGCTTTACAACTTCATAAGG - Intergenic
1084533556 11:69743502-69743524 TCCTGCTCTGAAACTTTTTCTGG + Intergenic
1086349565 11:85932102-85932124 TCCTGCTCTAAAACTTGCCCTGG - Intergenic
1086678644 11:89641088-89641110 TCCTGCTCTGGAACTTGCCTTGG - Intergenic
1087438863 11:98157875-98157897 TCCTGCCTTGGAACTTGCCTTGG - Intergenic
1089110359 11:116050977-116050999 TCCTGCTCTGTCACTTGGTCTGG - Intergenic
1091227142 11:133964485-133964507 TGCTGCTCTGAAACTTGCTGAGG + Intergenic
1092271090 12:7023926-7023948 TCCTGCATGGCAACTTCCTCAGG - Intronic
1092638589 12:10478793-10478815 TCCTGGTGTGCCACTTGCTAAGG + Intergenic
1093653277 12:21668570-21668592 TCCTGCTCTAAAACTTGCTTTGG - Intronic
1093886301 12:24465563-24465585 ACCTGCTTTGTGACTTTCTCAGG - Intergenic
1094371606 12:29744608-29744630 TCCTGCTTTACCACATACTCTGG + Intronic
1094384090 12:29874764-29874786 TTCGACTTTGCTACTTGCTCTGG + Intergenic
1095195850 12:39316095-39316117 CCCTGCTTTTCTACTTGCACTGG + Intronic
1095207810 12:39458690-39458712 TCCTGCTCTAAAACTTGCTTTGG - Intergenic
1096131003 12:49158948-49158970 TCCTGCTTTAAAACTTGCCTCGG - Intergenic
1096199794 12:49673442-49673464 GCCTGCTTTGCCACTGGCTTGGG - Intronic
1097582603 12:61476173-61476195 ACCTGCTCTGCAAATTTCTCTGG + Intergenic
1098056257 12:66508894-66508916 TACTGACTTGTAACTTGCTCTGG - Intronic
1098416163 12:70237548-70237570 TCCTGATTTACAGCTTGGTCAGG + Intergenic
1098448307 12:70590209-70590231 TCCAGGTTTGCAACTTTGTCTGG + Exonic
1098554990 12:71808213-71808235 TCCTGCTCTGAAACTTGCCTGGG + Intergenic
1098733444 12:74066726-74066748 TGCTGGTTTGCAGCCTGCTCTGG + Intergenic
1098930139 12:76402162-76402184 ACATGCTTTCCAACTGGCTCTGG - Intronic
1099577770 12:84402960-84402982 TCTTGCCTGGCAACTTCCTCAGG - Intergenic
1100363966 12:93902312-93902334 TCCTGCTCTAAAACTTGCCCTGG - Intergenic
1101269451 12:103128333-103128355 TCCTGCCCTGCACCTGGCTCAGG + Intergenic
1103093598 12:118115474-118115496 TCCTGCTGTGAAACTTGCCTTGG - Intronic
1104250449 12:127088615-127088637 TCCTGCTCTGGAACTTGCCTCGG - Intergenic
1105448260 13:20475719-20475741 TGATGCTGTGCAACTGGCTCTGG + Intronic
1107490144 13:40873870-40873892 TCTTGCCTGGCAACTGGCTCAGG - Intergenic
1107799743 13:44094639-44094661 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1109007273 13:56894001-56894023 TTCTGCTTTAAAACTTGCTTCGG - Intergenic
1109176833 13:59167502-59167524 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1109515815 13:63441359-63441381 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1109814097 13:67556425-67556447 GCCAACTTTGAAACTTGCTCTGG - Intergenic
1109823726 13:67691223-67691245 TCAGGCTTTGCAACTAGCTCAGG + Intergenic
1110877572 13:80528508-80528530 TCCTGCTCTGGAACTTGCCTTGG + Intergenic
1111188575 13:84777439-84777461 ACCTGCTCTGCAACTTGCTTTGG + Intergenic
1111344122 13:86926365-86926387 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1111351791 13:87041030-87041052 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1111476831 13:88761008-88761030 TCCTGCTCTAAAACTTGCCCTGG - Intergenic
1112020519 13:95367291-95367313 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1112761790 13:102699948-102699970 TCCTGCTTTGGATTTGGCTCTGG + Intergenic
1114219612 14:20684610-20684632 TCCTGCTTTGCATCTAGGTGGGG - Exonic
1114281448 14:21195920-21195942 TCCTGCTCTGGAACTTGCCATGG + Intergenic
1114438873 14:22730249-22730271 TCCTGCTCTGAAACTTGCCGTGG + Intergenic
1114758577 14:25286210-25286232 TCCTGCCTGGCAACTGCCTCAGG + Intergenic
1116103247 14:40467573-40467595 GCCTACTTTACAACTTGGTCAGG + Intergenic
1116727553 14:48580367-48580389 TCCTGCTCTGGAACTTGCCTTGG - Intergenic
1116747866 14:48844936-48844958 GCCTGCTTTTCTAGTTGCTCTGG - Intergenic
1117307748 14:54493104-54493126 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
1119295807 14:73532104-73532126 CCCTGCTTTGCCTCTTTCTCAGG - Intronic
1119299446 14:73559814-73559836 CCCTGCTTTGCCTCTTTCTCAGG - Intergenic
1123009199 14:105339065-105339087 CCCTGCTTTGCAAGTTCCTGGGG + Intronic
1123126184 14:105947689-105947711 TCCTGCTCTAAAACTTGCTTGGG - Intergenic
1123406693 15:20023743-20023765 TCCTGCTCTAAAACTTGCTTGGG - Intergenic
1123516023 15:21030391-21030413 TCCTGCTCTAAAACTTGCTTGGG - Intergenic
1123824865 15:24070972-24070994 TCTTGCTTGGCAACTGCCTCAGG + Intergenic
1130113071 15:80982223-80982245 TCTTGCTTTTCAACTGGCACAGG + Intronic
1130910967 15:88270535-88270557 TCCTGCTTTCCAACTTTCCCTGG + Intergenic
1131010056 15:89009793-89009815 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
1132046096 15:98563891-98563913 TCCTTCTTTGCACCATTCTCAGG - Intergenic
1132847568 16:2007459-2007481 TCTTGCTCTCCAGCTTGCTCTGG - Intronic
1133782705 16:8952339-8952361 CCCAGCTCTGCCACTTGCTCTGG + Intronic
1134367502 16:13592972-13592994 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
1135202930 16:20454525-20454547 TCTTGCTTGGCAACTGCCTCAGG - Intronic
1135216170 16:20573341-20573363 TCTTGCTTGGCAACTGCCTCAGG + Intronic
1135375948 16:21947615-21947637 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1135464402 16:22672824-22672846 CTCTGCTCTGCAACTTGCTGAGG + Intergenic
1136183957 16:28574126-28574148 TCCTGCTCTGAAACTTGCCTCGG - Intronic
1137031243 16:35526499-35526521 GCCTGCTGTGCAAAATGCTCAGG + Intergenic
1140420183 16:74813064-74813086 TCCTCCTTTGCAACTCTCTTCGG - Intergenic
1140724609 16:77800719-77800741 TGCTGCTTTGTAACCTGCACTGG - Intronic
1144631073 17:16872766-16872788 TCCAGCTTTGCCACTGTCTCAGG - Intergenic
1144650240 17:17002711-17002733 TCCAGCTTTGCCACTGTCTCGGG + Intergenic
1149443107 17:56691495-56691517 TCCTGCTTTTGCTCTTGCTCAGG + Intergenic
1153573208 18:6494563-6494585 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1155025922 18:21940962-21940984 ACCTGCTGTGGAACTGGCTCTGG - Intergenic
1155287628 18:24307373-24307395 CCCTGCTTTGTAACTTTCTTAGG + Intronic
1155455838 18:26012279-26012301 TCCTCCTTTGCAGCTTGGTGTGG - Intergenic
1156018347 18:32571184-32571206 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1157409680 18:47453359-47453381 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1157609929 18:48949933-48949955 TCCTGCTGTGCAAAGTGTTCAGG - Exonic
1159116188 18:64115408-64115430 TCCTTCTTTGCAAAGTCCTCAGG - Intergenic
1159144935 18:64442231-64442253 TCCTGCTTTGGAACTTGCCTAGG - Intergenic
1159539949 18:69761963-69761985 TTCTGCTTTGCAACTTGCCTAGG - Intronic
1164126649 19:22324502-22324524 TGCTGCTTTAAAACTTGCTTCGG - Intergenic
1164516788 19:28943610-28943632 TCCTTTTTTCCAAGTTGCTCTGG + Intergenic
1164606511 19:29602866-29602888 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1164612213 19:29640220-29640242 TCCTGCTCTGAAACTTGCTTTGG - Intergenic
1166372567 19:42310324-42310346 TCCTGCTCTGGGACTTGATCAGG - Exonic
1167567863 19:50268072-50268094 TACTGCCTTGTAACTTGCTTTGG - Intronic
1168542943 19:57228158-57228180 TGCTGCTTTCTAACCTGCTCTGG + Intergenic
925290778 2:2747274-2747296 TCTTGCTCTGCAAGATGCTCTGG + Intergenic
925692750 2:6541719-6541741 TCCTGCTCTGAAACTTGCCTAGG - Intergenic
926441686 2:12895585-12895607 TCCTGCTATGAACCTTCCTCTGG - Intergenic
927044938 2:19268049-19268071 TACTATTTTGCAACTTGCTTAGG - Intergenic
927893085 2:26764518-26764540 CCCTGCTTTCCCACTTGCTCCGG + Intronic
930946943 2:57085794-57085816 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
931401866 2:61938605-61938627 TCCTGCTCTGGAACTTGCCTTGG + Intronic
932197775 2:69798984-69799006 TACTGCTTAGCAACCTGCTCGGG - Intronic
932486951 2:72090004-72090026 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
932866956 2:75353763-75353785 TCCTGTTCTGCAACTAGCTGTGG - Intergenic
932870226 2:75390978-75391000 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
932972779 2:76565803-76565825 TCCTGCTTTGCCTCTTCCTTTGG - Intergenic
933643121 2:84785441-84785463 GCCTGCTTTGTATCTTGCTCAGG - Intronic
935180595 2:100687159-100687181 TCCTGCTCTGAAACTTGCTTTGG - Intergenic
935491246 2:103723004-103723026 TCCTGCATTGTAAGTTGCTAAGG - Intergenic
935631956 2:105219395-105219417 TCCTGCTTTGCGATATTCTCTGG - Intergenic
936097633 2:109544693-109544715 TACTGCTTTTCAACATGCTTTGG - Intronic
936157698 2:110059356-110059378 TCCTGCTGTGAAACTTGCCTTGG - Intergenic
936186994 2:110312088-110312110 TCCTGCTGTGAAACTTGCCTTGG + Intergenic
937210818 2:120268788-120268810 TCCTGCTCTGAAACTTGCCTCGG - Intronic
937509393 2:122577023-122577045 TTCTGTTTTGCAACTCTCTCTGG - Intergenic
937714608 2:125017141-125017163 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
937800007 2:126072260-126072282 TCCTGCCTGGCAACTGCCTCAGG - Intergenic
938290759 2:130148893-130148915 TCCTGCTCTGAAACTTGCTTCGG - Intergenic
938314514 2:130316671-130316693 TTCTGCTTTGCAGCTTTCCCTGG + Intergenic
938465789 2:131524060-131524082 TCCTGCTCTGAAACTTGCTTTGG + Intergenic
939152637 2:138491388-138491410 ACCTGTTTTGCAACTTGCTTTGG + Intergenic
939160433 2:138582571-138582593 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
940710419 2:157155860-157155882 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
940868436 2:158839440-158839462 TCCTGCTCTGAAACTTGCTTTGG + Intronic
941884597 2:170515071-170515093 TCCAGCTTTGGAACCTTCTCCGG - Intronic
941902474 2:170691611-170691633 TCCTGGTTTGCTCCTTACTCAGG - Intergenic
943249227 2:185495786-185495808 TCCTGCTCTGAAACTTGCATTGG - Intergenic
943649573 2:190442422-190442444 CCCTGCTTTGAACCTTGCTATGG - Intronic
944872991 2:203933046-203933068 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
945775572 2:214102787-214102809 TCCTGTTCTGGAACTTGCCCCGG - Intronic
948797043 2:240410770-240410792 ACCTGCTTTGCCGCTTGCCCAGG - Intergenic
1169948025 20:11010370-11010392 TGAAGCTTAGCAACTTGCTCAGG + Intergenic
1170062791 20:12276740-12276762 TCCTTCTTTGAAACTCACTCAGG - Intergenic
1170387894 20:15840348-15840370 TTCAGCTTTGCAACTTGCCGGGG + Intronic
1171509521 20:25670054-25670076 TCCTCTTTGGTAACTTGCTCTGG + Intergenic
1172456300 20:35077081-35077103 TCCTGCTGTGCCATTTGCTAAGG + Intronic
1172658518 20:36550791-36550813 GCCTGGTTTGGAACTTGTTCGGG - Exonic
1174536859 20:51258067-51258089 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1175839901 20:62020137-62020159 TCCTGCTATGCAAGTCACTCCGG + Intronic
1177530841 21:22355832-22355854 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1178931390 21:36821552-36821574 TCCTGCTCTGCGCTTTGCTCCGG + Intronic
1181340604 22:22176640-22176662 TCCTGATTTGCAACTGGTTAAGG - Intergenic
1181583349 22:23839671-23839693 TCCTGCCTGTCCACTTGCTCTGG - Intergenic
1182365903 22:29779126-29779148 TCCAACTTTGCACATTGCTCAGG - Intergenic
949749441 3:7333675-7333697 TGTTGGTTTTCAACTTGCTCTGG - Intronic
950480801 3:13242609-13242631 TCCTGCTCTGCTCCTTGCCCTGG + Intergenic
950869461 3:16216240-16216262 TCCTGCTTTAAAACTTGCTTTGG - Intronic
950958228 3:17077978-17078000 TACTGCTTTATAACTTGTTCTGG + Intronic
951250729 3:20391497-20391519 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
952254668 3:31684817-31684839 GCCTGCTTTGTAACTTCCACTGG - Intronic
952454136 3:33457142-33457164 TCCTGCTCTGGAACTTGCCCTGG - Intergenic
952723682 3:36559894-36559916 CCCTGCTTTGCACTGTGCTCAGG - Intergenic
954511942 3:51132993-51133015 TCCTGCCTGGCAACTGCCTCAGG - Intronic
954889577 3:53912967-53912989 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
955418964 3:58718366-58718388 TCCTGCATTTCCACATGCTCTGG - Intronic
955608377 3:60731320-60731342 TCCTGCTCTAAAACTTGCTTTGG - Intronic
956352017 3:68347826-68347848 TCCTTCTCTGCAACTTGTTCAGG + Intronic
957275080 3:78080712-78080734 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
958956643 3:100471628-100471650 GCCTGCTTTACAACTTGGTAAGG + Intergenic
960456736 3:117881677-117881699 TCCTGCTGAGGAACTTGCTAAGG - Intergenic
961886463 3:130099603-130099625 TCCTGCTGTGCCACGTGCTGGGG - Intronic
961942034 3:130647732-130647754 TCTTGCTTTACAACAAGCTCAGG - Intronic
962996511 3:140634060-140634082 TCCTGCTTTGCCATTTGCCAGGG - Intergenic
963174572 3:142284427-142284449 ACCTGCTTTACAACTTGGTAAGG + Intergenic
963268375 3:143261336-143261358 TCCTGCTCTGGAACTTGCCTTGG + Intergenic
965000244 3:162943820-162943842 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
965771115 3:172181974-172181996 GCCTGCTTTGCATCATTCTCAGG - Intronic
966649063 3:182278757-182278779 CCCTGCTTCACAACTTGCTATGG - Intergenic
969179408 4:5425383-5425405 GCCAGCTTTGCCACTTTCTCTGG - Intronic
970422752 4:15920458-15920480 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
971960932 4:33486211-33486233 TCCTGCTGTTCCACTTGCTGGGG - Intergenic
971968928 4:33596642-33596664 GCCTGCTTTACAACTTGGTAAGG + Intergenic
972703545 4:41517292-41517314 GCCTCCTTTGCAATTTGCTGTGG - Intronic
972943957 4:44230056-44230078 TCCTGCTCTGAAACTTGCCTTGG + Intronic
973930493 4:55789067-55789089 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
974627929 4:64447461-64447483 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
974691238 4:65300116-65300138 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
976818267 4:89175184-89175206 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
977079374 4:92504369-92504391 TCCTATTTTCCAACTTGCTTAGG - Intronic
977582868 4:98744478-98744500 TCCTGCTCTAAAACTTGCTTTGG - Intergenic
979466368 4:121043306-121043328 TACTGCTGTGCAACTTTATCTGG + Intronic
980005871 4:127541967-127541989 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
980032310 4:127845137-127845159 TCCTGCTCTGGAACTTGCCTTGG - Intergenic
980681031 4:136160349-136160371 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
981525652 4:145704804-145704826 TCCTGCTCTGAAACTTGCCTTGG - Intronic
982076150 4:151739073-151739095 TCATGCTTTGCAGCTTTCTTAGG - Intronic
984113087 4:175644274-175644296 TCCTGCTCTGAAACTTGCCCCGG + Intronic
985490778 5:177611-177633 TCCTGCTCTGAAACTTGCCTGGG - Intronic
985915711 5:2917580-2917602 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
986219232 5:5752453-5752475 TCCTGCTCTGAAACTTGTCCCGG + Intergenic
986454599 5:7903721-7903743 TCCTGCTCTGAAACTTGCCTTGG - Intronic
986650461 5:9958656-9958678 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
987038405 5:14039897-14039919 ACATTCTTTGCTACTTGCTCTGG + Intergenic
987205254 5:15618884-15618906 TCCTGCTCTGAAACTTGCCTCGG - Intronic
987664818 5:20923426-20923448 TTCTGCTCTGAAACTTGCTTTGG + Intergenic
988268723 5:28986418-28986440 TCCTGCTTAGCACCTGCCTCAGG + Intergenic
988274605 5:29064938-29064960 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
989321705 5:40142505-40142527 TCATGCTTTGTAACTTCCTCAGG - Intergenic
989999825 5:50879868-50879890 TCCTGCTCTAAAACTTGCTTTGG + Intergenic
991686354 5:69185782-69185804 TCCTGCTCTGAAACTTGCCTGGG - Intergenic
993343077 5:86749112-86749134 ACTTGTCTTGCAACTTGCTCTGG - Intergenic
994399652 5:99263646-99263668 TCCAGCTTGTCAACTGGCTCTGG - Intergenic
994665893 5:102704989-102705011 TCCTCCTTCCCAACTTGTTCAGG + Intergenic
995191396 5:109322415-109322437 TCCTGCTTTGAAACTTGCCTTGG + Intergenic
995582072 5:113612914-113612936 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
996213513 5:120840253-120840275 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
997537706 5:134635394-134635416 TCTTGCTTATCAAGTTGCTCAGG - Intronic
998261698 5:140636613-140636635 ACCTGCTGTGCACCATGCTCTGG - Intergenic
998740983 5:145201415-145201437 TCCTGCTCTGGAACTTACTAAGG + Intergenic
999491542 5:152056233-152056255 TCCTGATTTCCAGCTGGCTCTGG + Intergenic
1001916141 5:175561711-175561733 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
1002129417 5:177070987-177071009 AGCTGCTTTGCATCTAGCTCTGG - Intronic
1002262264 5:178002096-178002118 TCCTGCTATGCAACATTGTCCGG + Intergenic
1002295965 5:178231683-178231705 TCCTGCTTTGCAACCACCTGTGG - Intronic
1003196393 6:3918937-3918959 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
1003758275 6:9147554-9147576 TCTTGCTTGGCAACTGCCTCAGG - Intergenic
1005260639 6:24055731-24055753 TGCTGCTTTGAAACAAGCTCTGG + Intergenic
1006429884 6:33988952-33988974 CCCTGCTTTAAAACTTGTTCTGG + Intergenic
1007378194 6:41470484-41470506 TCCGGCTTAGCAGCTCGCTCCGG - Intergenic
1007477825 6:42130697-42130719 TCATGCTTGCCAAGTTGCTCAGG - Intronic
1007847180 6:44769015-44769037 TCCTGCTCTAAAACTTGCTTCGG - Intergenic
1008005805 6:46407698-46407720 TCCTACTTTGCAACAGGGTCAGG + Intronic
1008369285 6:50714743-50714765 TCCAGGTTTGCAACTGACTCCGG - Intronic
1008516468 6:52323934-52323956 TCCTGCTCTGAAACTTGCCTGGG - Intergenic
1008939619 6:57032077-57032099 TCCTGCTCTGAAACTTGCCTCGG - Intergenic
1009521105 6:64682822-64682844 TCCTGCTCTGAAACTTGCCTGGG + Intronic
1010323252 6:74537973-74537995 TCCTGCCTGGCAACTGCCTCAGG - Intergenic
1010370536 6:75101903-75101925 TTCTGCTTTGCTACTTAATCTGG + Intronic
1010552490 6:77239519-77239541 TTCTGCTTTGGAACTTGGACTGG + Intergenic
1012921120 6:105221968-105221990 TCTTGCCTGGCAACTGGCTCAGG + Intergenic
1014032069 6:116717592-116717614 TCCTGCTCTGAAACTTGCCTTGG - Intronic
1014163155 6:118193798-118193820 TCCTGCTTTACAGCTTGGTAAGG - Intronic
1014523617 6:122474850-122474872 TCCTGCTTTACATTTTTCTCAGG - Intronic
1015160623 6:130148899-130148921 CCCTGGTGTGCAACTTGCTACGG + Intronic
1015813378 6:137183718-137183740 GCCTGCTTTACAACTTGGTAAGG - Intergenic
1016720306 6:147288736-147288758 TCCTGCTCTGAAACTTGCCTTGG - Intronic
1016936602 6:149452658-149452680 TCCTGCTCAGGAAGTTGCTCAGG + Exonic
1017779835 6:157707314-157707336 TCCTGCTCTGAAACTTGCCTCGG - Intronic
1018065268 6:160120995-160121017 TCCTGCTTTGCAGTTTGGTAGGG - Intergenic
1018863692 6:167731630-167731652 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
1019817729 7:3213394-3213416 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
1020389606 7:7643866-7643888 TCCTGCTCTGGAACTTGCCTGGG + Intronic
1020956233 7:14742600-14742622 GCCTGCTTTACAACTTGGTAAGG + Intronic
1021598191 7:22339259-22339281 TCCTGCTCTAAAACTTGCTTCGG + Intronic
1023603527 7:41905498-41905520 TCCTGCTGTGCAAGTTTCTATGG + Intergenic
1024250973 7:47505446-47505468 TCTTGCTTTCCACCCTGCTCTGG - Intronic
1025849634 7:65235538-65235560 TCCTGCTTTGAAACTTGCCTTGG + Intergenic
1026930458 7:74220523-74220545 CCCTGCTTTGCACCCAGCTCGGG - Intronic
1030134607 7:106234832-106234854 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1030606352 7:111642808-111642830 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1030628666 7:111871410-111871432 TCCTCCTTTTCTACTGGCTCAGG - Intronic
1030825755 7:114155744-114155766 TCCTGCTTTAAAACTTGCCTCGG - Intronic
1031779440 7:125942738-125942760 TCTTGCCTCACAACTTGCTCAGG + Intergenic
1034286018 7:149883464-149883486 TCCTGCTCTGCCACTTGGTATGG - Intergenic
1034916519 7:155044406-155044428 TCCTGCTCTAAAACTTGCTTTGG + Intergenic
1035230372 7:157462237-157462259 TCCTCCTTGGCAGCTTGCCCAGG + Intergenic
1036611045 8:10350217-10350239 ACCTGCTTTGCAGATAGCTCTGG + Intronic
1037470352 8:19202399-19202421 TCCTTCTTTTCCACTTTCTCTGG - Intergenic
1038526864 8:28282012-28282034 TCCTGCCTTGGAACTTGGACTGG + Intergenic
1038941028 8:32306096-32306118 TCCTGTTTTTAAACTTGCTGAGG - Intronic
1039500058 8:38009546-38009568 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1039959216 8:42232859-42232881 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1041720784 8:60973530-60973552 TCCTGCTCTAAAACTTGCTTCGG - Intergenic
1043068319 8:75604651-75604673 TAGTGCTTGGAAACTTGCTCAGG - Intergenic
1044088257 8:87968618-87968640 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1046447559 8:114342467-114342489 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1051109479 9:13619540-13619562 TGCTGCTTTGAGTCTTGCTCTGG + Intergenic
1052664106 9:31472288-31472310 TCCTGCTCTAAAACTTGCTTTGG + Intergenic
1053582958 9:39425938-39425960 TCCTGCTGTGCCATTTGCTAAGG - Intergenic
1053847140 9:42250799-42250821 TCCTGCTGTGCCATTTGCTAAGG - Intergenic
1054104537 9:60984681-60984703 TCCTGCTGTGCCATTTGCTAAGG - Intergenic
1054581805 9:66922168-66922190 TCCTGCTGTGCCATTTGCTAAGG + Intronic
1054968471 9:71057154-71057176 TACTGCTTTTCCACTTGCCCAGG + Intronic
1055253610 9:74338697-74338719 TCCTGCTCTGGAACTTGCCTGGG - Intergenic
1055258108 9:74397483-74397505 TCTTCCTTTGCAACTTGGTAAGG - Intergenic
1057034311 9:91800643-91800665 TCCTGTTTTCCATCTTGATCAGG - Intronic
1058143433 9:101382622-101382644 TCCTGCTCTGAAACTTGCCTTGG + Intronic
1059209162 9:112495802-112495824 TTTGGCTTTGTAACTTGCTCTGG + Intronic
1059849409 9:118320630-118320652 TCCTGCTCTGGAACTTGCCTTGG - Intergenic
1059856324 9:118401642-118401664 TCCTTCTTTGCACATTGCCCAGG - Intergenic
1060975589 9:127763057-127763079 CCCTCCTTGGCAACTTGTTCCGG + Intronic
1061328141 9:129876328-129876350 GACTGCTTTCAAACTTGCTCAGG - Intronic
1062295259 9:135821845-135821867 TACTCCTTTGCAAAGTGCTCCGG + Exonic
1185545259 X:938312-938334 CCCTGATTTGCAACTGGCTAAGG - Intergenic
1185757503 X:2663379-2663401 TCCTGCTCTGAAACTTGCCCGGG + Intergenic
1185785679 X:2889134-2889156 TCCTGCTTTGAAACTTGCCTTGG - Intergenic
1186021853 X:5264946-5264968 TCCTGCTCTGAAACTTGCTTTGG + Intergenic
1186354037 X:8771779-8771801 GCCTGCTTTACAACTTGGTGAGG - Intergenic
1186664777 X:11705711-11705733 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1187216846 X:17285574-17285596 TCCTGCTCTGAAACTTGCAGGGG - Intergenic
1187387715 X:18863348-18863370 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1187604552 X:20869567-20869589 TCTTGCTTGGCAACTGCCTCAGG - Intergenic
1188071092 X:25719297-25719319 TCCTGCTTTCGTATTTGCTCAGG - Intergenic
1188159327 X:26781467-26781489 ACCTGCTTTACAACTTGGTAAGG - Intergenic
1188752800 X:33924269-33924291 TCCTGCTCTGAAACTTGCTTTGG - Intergenic
1188865787 X:35311748-35311770 TCCTGCTCTGCAACTTGCCTTGG - Intergenic
1188881162 X:35493473-35493495 TCCTGCTCTGAAACTTGCTTTGG + Intergenic
1189253197 X:39617219-39617241 TCCAGGTTTCCCACTTGCTCTGG - Intergenic
1189492466 X:41480898-41480920 TCCTGCTTTAAAACTTGCCTAGG + Intergenic
1189632691 X:42972164-42972186 GCCTGCTTTACAACTTGATAAGG - Intergenic
1192963554 X:76153940-76153962 TCCTGCTCTGAAACTTGCCTCGG + Intergenic
1193251956 X:79301492-79301514 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1193449802 X:81651786-81651808 TCCTGCTCTGACACTTGCTGCGG + Intergenic
1193518723 X:82503009-82503031 TCCTGCTCTGAAACTTGCCTTGG + Intergenic
1194059505 X:89179963-89179985 GCCTGCTTTACAACTTGGTAAGG - Intergenic
1194234179 X:91361695-91361717 TCCTGCTCTGAAACTTGCCTAGG - Intergenic
1194648066 X:96482621-96482643 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1194946423 X:100073998-100074020 TCCTACTTTGCCATTTGGTCTGG - Intergenic
1195928583 X:110050697-110050719 TCCTGCTTTGCAATTGGGTCAGG + Intronic
1196438635 X:115696828-115696850 TCATCCTTTGCCACTTGCCCAGG - Intergenic
1197245430 X:124161813-124161835 TCTTGCTTGGCAACTGCCTCAGG + Intronic
1197426056 X:126298109-126298131 TCTTGCCTTGCAACTGCCTCAGG + Intergenic
1198048260 X:132924155-132924177 TCCTGGTTTCCAACTTGAGCTGG - Intronic
1198783361 X:140260292-140260314 TCTTGCTTGGCAACTGCCTCAGG + Intergenic
1199219352 X:145299038-145299060 TCCTACTCTGCAACTTGCCTCGG - Intergenic
1199276126 X:145944629-145944651 TCCTGCTCTGAAACTTGCCTTGG - Intergenic
1199311771 X:146329369-146329391 TACTACTTGGCAACCTGCTCAGG - Intergenic
1199871297 X:151901156-151901178 TCCTGGTCTTCAACTTGCCCTGG - Intergenic
1200269011 X:154663400-154663422 TCCTGCTCTGGAACTTGCCTCGG + Intergenic
1202173823 Y:22079387-22079409 TCCTGCTGTGAAACTTGCCATGG - Intronic
1202217537 Y:22506995-22507017 TCCTGCTGTGAAACTTGCCATGG + Intronic
1202325648 Y:23689064-23689086 TCCTGCTGTGAAACTTGCCATGG - Intergenic
1202545123 Y:25980990-25981012 TCCTGCTGTGAAACTTGCCATGG + Intergenic