ID: 917793683

View in Genome Browser
Species Human (GRCh38)
Location 1:178516295-178516317
Sequence CAACCACCTGTAGCATCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917793677_917793683 29 Left 917793677 1:178516243-178516265 CCCTGAGCAAGTTGCAAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84
917793679_917793683 28 Left 917793679 1:178516244-178516266 CCTGAGCAAGTTGCAAAGCAGGA 0: 1
1: 0
2: 0
3: 35
4: 339
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84
917793676_917793683 30 Left 917793676 1:178516242-178516264 CCCCTGAGCAAGTTGCAAAGCAG 0: 1
1: 0
2: 0
3: 19
4: 202
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84
917793680_917793683 3 Left 917793680 1:178516269-178516291 CCTCTCATTTCTATGATACAACC 0: 1
1: 0
2: 0
3: 5
4: 154
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917793683 Original CRISPR CAACCACCTGTAGCATCCTT AGG Intronic
902553701 1:17234401-17234423 CAACCACCTCTTGAATGCTTAGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907548819 1:55286890-55286912 AAGCCAACTGTAGCCTCCTTAGG + Intergenic
909540867 1:76790057-76790079 GAAGTAGCTGTAGCATCCTTTGG - Intergenic
915382306 1:155452892-155452914 CTACCAACTGTAGAGTCCTTGGG - Intronic
917043213 1:170829382-170829404 AAAACACCTGTAGCATGGTTGGG - Intergenic
917597243 1:176541498-176541520 AAATCACCCCTAGCATCCTTGGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918552105 1:185755375-185755397 CAACCTCCTGAATCAGCCTTAGG - Intronic
920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG + Intergenic
922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG + Intronic
922988588 1:229886061-229886083 CAAGCACATGTTGCTTCCTTGGG - Intergenic
1067393815 10:45892425-45892447 CACCTACCTGTAGCATGCCTCGG + Intergenic
1067862139 10:49861581-49861603 CACCTACCTGTAGCATGCCTTGG + Exonic
1068030341 10:51698312-51698334 CTACCACCTCTACCATCCATAGG + Exonic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1077925873 11:6681725-6681747 CAACCACCTCTGGCAACATTTGG + Exonic
1080209046 11:29764100-29764122 CAAACACTTGGAGCATCCTTTGG - Intergenic
1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG + Intronic
1083354118 11:62052802-62052824 CAATCACATATAGCAGCCTTTGG - Intergenic
1084943545 11:72626869-72626891 CAACCTCCTGCAGCCTCCTCTGG + Intronic
1094215161 12:27932765-27932787 CAACAACCTTTAGCATCTTCTGG - Intergenic
1095640186 12:44478228-44478250 CATTCATCTGTAGCATCATTGGG - Intergenic
1102941958 12:116950856-116950878 CACCAAACTGTAGCATCCGTGGG - Intronic
1103890513 12:124235268-124235290 GAACCACTTGTGGCACCCTTAGG - Intronic
1104602016 12:130161153-130161175 GAAGCACCTGGCGCATCCTTGGG + Intergenic
1110552767 13:76827071-76827093 GAACTACCTGTATCATACTTTGG - Intergenic
1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG + Intronic
1122686478 14:103510383-103510405 CAGCCACCTATCTCATCCTTGGG - Intergenic
1128456508 15:67834484-67834506 CAACCACCTGGAGCCTGTTTGGG + Exonic
1134221756 16:12360505-12360527 CCACCACCTGTGACATCGTTGGG - Intronic
1134289968 16:12896541-12896563 CAATCATCTGTAACATCCCTGGG + Intergenic
1137712448 16:50575793-50575815 CCACCATTTGTTGCATCCTTTGG + Intronic
1139671257 16:68493520-68493542 CAACTACCTGCAGCCTCCCTTGG + Intergenic
1141338969 16:83185125-83185147 CGACCAGCTGTAGGACCCTTAGG - Intronic
1147490704 17:40863449-40863471 CAAACAGACGTAGCATCCTTTGG - Intronic
1156586459 18:38436506-38436528 AAACCAACTGTAGCATGATTTGG + Intergenic
1162551725 19:11361824-11361846 CTAGCGCCTGTAGCATCCTGGGG - Intronic
1163512003 19:17741076-17741098 CCACCCCCTACAGCATCCTTTGG + Intergenic
1167592810 19:50413626-50413648 CACTCTCCTGTTGCATCCTTGGG + Intronic
1168465896 19:56600957-56600979 GAACCACCTGTGGCCTCTTTGGG - Intronic
925088146 2:1129201-1129223 GAACCACCTGTAGTTTTCTTAGG - Intronic
931676636 2:64702962-64702984 CAACCAACTGAAGCATCCTGAGG + Intronic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
939292313 2:140212130-140212152 CAACCTCCTGTCTCATCCTGTGG + Intergenic
939995424 2:148915246-148915268 CACCCTCCTCTAGCATCCCTGGG + Intronic
946479292 2:220038492-220038514 CAAATTCCTGTATCATCCTTAGG - Intergenic
947298826 2:228665407-228665429 CAACCACCCACAGCATCCTGGGG - Intergenic
1168924204 20:1566196-1566218 CAACCACCAGTAGCAGCTTGGGG + Exonic
1170671736 20:18440581-18440603 CAACCACCTGTTGCATTCTAGGG - Intronic
1171299933 20:24051343-24051365 CCACCACCTGTCTCATCCTCAGG + Intergenic
1173910905 20:46670100-46670122 CACCCATATGTAGCTTCCTTTGG + Intronic
1179039620 21:37790850-37790872 CAAACACCAGTATGATCCTTTGG - Intronic
1182223923 22:28781143-28781165 CAATCTCCTGAAGCTTCCTTCGG - Exonic
1182231070 22:28837928-28837950 CAACCACCAGTAGCATGATGAGG + Intergenic
1182253010 22:29016812-29016834 CAAGCACCTGTAGCATGCTAGGG + Intronic
951575955 3:24114335-24114357 CAAACACCTAGCGCATCCTTTGG + Intergenic
952250481 3:31648489-31648511 CAGCCACCTGTGGAATGCTTTGG - Intergenic
955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG + Intronic
955853978 3:63253379-63253401 TAAACAACTGTAGCATCATTTGG + Intronic
964770955 3:160224636-160224658 CAATCACTTGTAACCTCCTTAGG + Intergenic
972958563 4:44422879-44422901 CAGCCACCTCTACCATCCTGAGG - Intronic
974438937 4:61892692-61892714 CTACCACCAGTACCACCCTTCGG + Exonic
977796329 4:101169463-101169485 CAACCACCTGTGGCAACCCTGGG + Intronic
978837183 4:113164969-113164991 CAACCACCTATAACAACATTTGG - Intronic
981498523 4:145420852-145420874 CAACAACCTGAAGCAACCTGGGG - Intergenic
983515819 4:168655566-168655588 CAACCAACTGAAGCATCATTTGG + Intronic
992096735 5:73369762-73369784 CAACCTCCATTGGCATCCTTTGG - Intergenic
993891294 5:93477655-93477677 CTATCACCTGTAGCATTCTGAGG + Intergenic
994787303 5:104180913-104180935 CATTCATCTGTAGCATCATTAGG - Intergenic
996281011 5:121729011-121729033 CAACCACCTTAAGCATTCTCAGG + Intergenic
1004385619 6:15170298-15170320 CAACAGACTGTAGCCTCCTTGGG + Intergenic
1006592835 6:35170827-35170849 CACACACCTGTACCATCCTCTGG - Intergenic
1006671600 6:35732713-35732735 CAACTACCTGTGGAATCCTAAGG - Intergenic
1010567218 6:77431024-77431046 CTACCACCTCTAGTATCCCTAGG + Intergenic
1012930136 6:105307997-105308019 TCACCATCTTTAGCATCCTTTGG + Intronic
1016702397 6:147068290-147068312 TAATGACCTGTAGCATGCTTTGG + Intergenic
1019701667 7:2477241-2477263 CACCCACCTGCAGCAGCCCTAGG - Intergenic
1020241909 7:6401731-6401753 GAACCACCTGAAGCCTCCGTGGG + Intronic
1028887754 7:95953223-95953245 TAAGCAACTGTAGCATCTTTTGG + Intronic
1034204624 7:149304780-149304802 GAACCAGCTGCAGCTTCCTTCGG + Intergenic
1034425654 7:151012805-151012827 GAACACCTTGTAGCATCCTTAGG - Exonic
1042668974 8:71239730-71239752 CAAGCACCTGTGAGATCCTTTGG + Intronic
1050184932 9:2963255-2963277 CAACCACCTTTTCCATCATTAGG + Intergenic
1061092414 9:128434086-128434108 CAACCACCTGTGGCATACAATGG - Exonic
1061559993 9:131395688-131395710 CCAGCACCTGTGGCATCCATGGG - Intronic
1191688941 X:63920495-63920517 CCACCACCTGCAGTCTCCTTAGG + Intergenic
1194997754 X:100610444-100610466 CGACCACCTGTCTCATCCTGTGG - Intergenic
1196610714 X:117711546-117711568 AAACCATCCATAGCATCCTTAGG - Intergenic
1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG + Intergenic
1201965579 Y:19730507-19730529 CAATCACCTATAGCCTCCATTGG - Intronic