ID: 917793683

View in Genome Browser
Species Human (GRCh38)
Location 1:178516295-178516317
Sequence CAACCACCTGTAGCATCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917793679_917793683 28 Left 917793679 1:178516244-178516266 CCTGAGCAAGTTGCAAAGCAGGA 0: 1
1: 0
2: 0
3: 35
4: 339
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84
917793677_917793683 29 Left 917793677 1:178516243-178516265 CCCTGAGCAAGTTGCAAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84
917793680_917793683 3 Left 917793680 1:178516269-178516291 CCTCTCATTTCTATGATACAACC 0: 1
1: 0
2: 0
3: 5
4: 154
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84
917793676_917793683 30 Left 917793676 1:178516242-178516264 CCCCTGAGCAAGTTGCAAAGCAG 0: 1
1: 0
2: 0
3: 19
4: 202
Right 917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917793683 Original CRISPR CAACCACCTGTAGCATCCTT AGG Intronic