ID: 917795535

View in Genome Browser
Species Human (GRCh38)
Location 1:178530241-178530263
Sequence GGCCAGTGCTGTGGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 380}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917795535_917795541 8 Left 917795535 1:178530241-178530263 CCATCACTGCCACAGCACTGGCC 0: 1
1: 0
2: 3
3: 36
4: 380
Right 917795541 1:178530272-178530294 ACTCACAACATTCCTTCTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 196
917795535_917795542 9 Left 917795535 1:178530241-178530263 CCATCACTGCCACAGCACTGGCC 0: 1
1: 0
2: 3
3: 36
4: 380
Right 917795542 1:178530273-178530295 CTCACAACATTCCTTCTCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 279
917795535_917795545 23 Left 917795535 1:178530241-178530263 CCATCACTGCCACAGCACTGGCC 0: 1
1: 0
2: 3
3: 36
4: 380
Right 917795545 1:178530287-178530309 TCTCCTGGGTCACAGGCCACAGG 0: 1
1: 0
2: 2
3: 42
4: 363
917795535_917795543 16 Left 917795535 1:178530241-178530263 CCATCACTGCCACAGCACTGGCC 0: 1
1: 0
2: 3
3: 36
4: 380
Right 917795543 1:178530280-178530302 CATTCCTTCTCCTGGGTCACAGG 0: 1
1: 0
2: 2
3: 33
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917795535 Original CRISPR GGCCAGTGCTGTGGCAGTGA TGG (reversed) Intronic
900132159 1:1091779-1091801 GGGCGGGGCTGTGGCAGGGAGGG + Intronic
900138280 1:1127989-1128011 GGCCCGTGCTGTGGGAGTGGGGG + Intergenic
900302451 1:1984866-1984888 GGTCAGTGCTGTGGATGTCATGG + Intronic
900382360 1:2391291-2391313 GGCGAGTCCTGTGGGAGTGGGGG + Intronic
900580471 1:3406114-3406136 GCCCAGTGCTGTTCCAGTGCGGG + Intronic
901002878 1:6157389-6157411 TGCCTCTGCTGTGGCAGTGTTGG - Intronic
901462607 1:9400626-9400648 GGCCAGGTCTCTGGCAGTGGGGG + Intergenic
901855053 1:12039188-12039210 GGCCAGTGCTGAGGCTGTGAGGG + Intergenic
904285314 1:29450026-29450048 GGCCATTGCAGGGGCAGTGGAGG + Intergenic
904893015 1:33793369-33793391 GGCCTGAGCTATGGCAGAGATGG + Intronic
905355816 1:37383604-37383626 GGCCAGTGTTGTTGGAGCGAAGG - Intergenic
905383474 1:37581538-37581560 TGCCAGGGCTGTGGCAGAAATGG + Intronic
905824366 1:41017535-41017557 AGGCAGTGCTGGGGCAGGGACGG - Intronic
905866116 1:41377627-41377649 TGCCAGGGCTGTGGCTGTGGTGG + Intronic
906144371 1:43551168-43551190 GGCCAGTGGAGTGCCAGTCAAGG + Intronic
907306559 1:53516382-53516404 GAGCAGGGCTGTGGCAGGGACGG + Intronic
907491417 1:54811205-54811227 GAACAGTGCTGTGACAGGGAAGG - Intronic
907571355 1:55487153-55487175 GGCCACAGCTGTGGAAGTGAAGG - Intergenic
908793849 1:67811524-67811546 GGCCAGTGATGTGGTACTGGAGG - Intronic
910269574 1:85379293-85379315 GGCCGATGCTGTGGATGTGATGG - Intronic
910490645 1:87765646-87765668 GATCAGTGCTCTGGAAGTGAAGG - Intergenic
912551952 1:110490348-110490370 GGCCCCTGGTGAGGCAGTGATGG + Intergenic
914746479 1:150505085-150505107 GCCCAGTCTTGTGGCTGTGAGGG - Intronic
915139805 1:153760356-153760378 GTCCAGGAGTGTGGCAGTGATGG - Exonic
915142705 1:153777042-153777064 GGCCTGTGGGGTGGCAGTTATGG - Exonic
915268618 1:154735817-154735839 GCCCTGTGCTGAGGCAGTGGTGG + Intronic
915556181 1:156662013-156662035 GGACAGTGCTGTGGGAGTTGGGG - Intergenic
917795535 1:178530241-178530263 GGCCAGTGCTGTGGCAGTGATGG - Intronic
917962875 1:180158323-180158345 GGCCTGTGCCGTGGAAGAGAAGG - Intronic
917980837 1:180267971-180267993 GGCCAGAGCTGTGGGGGTGGTGG - Intronic
918076932 1:181177549-181177571 GGTCCTTGCTGTGGCAGAGAAGG + Intergenic
918518526 1:185388986-185389008 GGCAAGTGCTGGGGCAGTGTGGG - Intergenic
919856487 1:201709661-201709683 GGCCACTGCTGGGGCACAGAGGG + Intronic
920385886 1:205569750-205569772 GGCCAGCTCTGTGGCGGTGCAGG + Intronic
920463456 1:206160754-206160776 GCTCATTGCTGTAGCAGTGATGG - Intergenic
920842391 1:209565695-209565717 GGCCAGTACTGGGGATGTGAGGG - Intergenic
922654993 1:227374316-227374338 GGCCAGTGCTGCATGAGTGAGGG + Intergenic
923873098 1:238017527-238017549 TGGCTGTGCTGTGGCAGTGATGG - Intergenic
923982312 1:239338865-239338887 GGCCAGGGCGGTCTCAGTGAAGG - Intergenic
924387390 1:243511399-243511421 GGCTAATGCTGTGCCAGAGATGG - Intronic
1062899587 10:1132782-1132804 GACCAGGGCTGTGGCTGTGGTGG + Intergenic
1062939913 10:1413296-1413318 CCCCAGTGCTGTGTCAGTGTCGG - Intronic
1063253014 10:4294810-4294832 GACCAGCGGTGTGGCAGTGGGGG + Intergenic
1067165618 10:43864368-43864390 GGGCTGTGCTGTGGCTGTGCTGG + Intergenic
1067427531 10:46221148-46221170 GGGCGATGCTGAGGCAGTGAGGG + Intergenic
1067525290 10:47034960-47034982 GGCAGGTGCTCCGGCAGTGACGG - Intergenic
1067707960 10:48625075-48625097 AGCCAGTGAACTGGCAGTGAAGG - Intronic
1068318867 10:55383313-55383335 GCAGAGTGGTGTGGCAGTGAAGG - Intronic
1069350894 10:67525705-67525727 AGCCAGGGCGTTGGCAGTGAGGG - Intronic
1069867346 10:71511961-71511983 GGGCTGGGCGGTGGCAGTGAAGG + Intronic
1070680883 10:78448255-78448277 GGCCAGAGCTGTGCAGGTGACGG + Intergenic
1073099280 10:100998503-100998525 GGCCAGGGCTGTGGCCTGGAAGG + Intronic
1073423498 10:103442416-103442438 GGCCCGTGCCGTGGCTGAGAGGG + Exonic
1073466692 10:103698346-103698368 GGCAAGTGCCTTGGCAGAGAAGG + Intronic
1074123684 10:110511786-110511808 GCCTAGTGCGATGGCAGTGAAGG - Intergenic
1074443691 10:113500525-113500547 GGCCAGTGAAGTGGCAGGGTTGG - Intergenic
1074653283 10:115550597-115550619 GGCCAGTGCAGCATCAGTGAGGG + Intronic
1074950265 10:118327668-118327690 GGCCAGTGCTGCTTCAGTCATGG + Intronic
1075559755 10:123460101-123460123 GACTATTCCTGTGGCAGTGAAGG + Intergenic
1075721712 10:124591289-124591311 GGGCAGAGCTGGGGCAGTCAGGG + Intronic
1075846585 10:125549801-125549823 GGCCAGTGCAGAGCCAGTGTGGG + Intergenic
1076319700 10:129568838-129568860 GGCCAGAGCTGTTGCAGCGCAGG - Intronic
1076693345 10:132234909-132234931 GGCAAGTGATGTGGCTGTGAAGG + Intronic
1076789430 10:132768859-132768881 GGCGGGGACTGTGGCAGTGATGG - Intronic
1076861460 10:133140113-133140135 GGGCAGGGCAGGGGCAGTGAAGG - Intergenic
1076903805 10:133352452-133352474 GGACAGGGCGGGGGCAGTGATGG - Exonic
1077230691 11:1457061-1457083 GGCCTGTGCTGGGGCGGGGAGGG + Intronic
1077472077 11:2768768-2768790 AGGCAGTGCAGGGGCAGTGAGGG + Intronic
1077902904 11:6504406-6504428 GACCATTGCTGAGGCAATGATGG - Intronic
1078458484 11:11494491-11494513 AGTCAGTGCTGTGGAAGAGATGG - Intronic
1079250416 11:18783017-18783039 GGACAGTGATGTGGCACAGAAGG + Intronic
1080641802 11:34162680-34162702 AGCCAGGGCAGTGGCAGCGAGGG - Exonic
1080699714 11:34634415-34634437 AGCCAGTTCTGTGGCAGTTTGGG + Intronic
1080846992 11:36035343-36035365 CACCAGTGCTGTGGCGGTGGAGG - Intronic
1081308098 11:41537880-41537902 GACCAGGGTTGTTGCAGTGAAGG + Intergenic
1081604175 11:44517061-44517083 GGCCAGTGGAGTGGGAGTGATGG + Intergenic
1083205419 11:61145870-61145892 GGCCAGGGCTCTGGTACTGAGGG - Intronic
1083641738 11:64149385-64149407 GGCCAGGGCTGGGGCAGTGCTGG - Intronic
1083679513 11:64344701-64344723 GGCCAGTGGTGTCGCAGAGCAGG + Exonic
1084519123 11:69652426-69652448 GGCCACTGTGGTGGCAGTGGAGG + Exonic
1086823894 11:91471230-91471252 GGCAAGAGATGTGGCAGAGAGGG - Intergenic
1088844468 11:113653115-113653137 GGCTAGTGTCATGGCAGTGAAGG - Intergenic
1089120741 11:116132858-116132880 GGTCAGAGCTGTGGCAATGATGG - Intergenic
1089140166 11:116278098-116278120 GGCCAGGGCTGGGGGAGGGAAGG - Intergenic
1089418975 11:118316697-118316719 AGCCAGGGCTGGGGAAGTGAAGG + Intergenic
1089628217 11:119765148-119765170 GGCCAGAGTGGTGGCAGTGGAGG - Intergenic
1090260246 11:125314281-125314303 AGCAAGTGATGTCGCAGTGAGGG - Intronic
1091595172 12:1873588-1873610 GTTCAGTGCTGTGGCCGTGCTGG + Intronic
1091767342 12:3130196-3130218 TGCCAGTGCGCTGGCACTGAGGG - Intronic
1091890671 12:4051730-4051752 GGCCAATGCTGTGGTTGTGGTGG + Intergenic
1092053877 12:5493019-5493041 AGCCAGTGAGGTGGCAGCGATGG + Intronic
1095328417 12:40926694-40926716 GGCCAGAGTGGTGGCAGTGGAGG + Intronic
1097546668 12:61011172-61011194 AGCCAGTGCTTTGGCTGTCATGG - Intergenic
1097899605 12:64859515-64859537 GGCCTGTGAGGAGGCAGTGAAGG + Intronic
1097929234 12:65166330-65166352 TGACAGTGTTGAGGCAGTGAAGG + Intergenic
1098345101 12:69494278-69494300 GGCCAGAGCTCTGTCTGTGATGG + Intronic
1099997673 12:89796607-89796629 TGCCAGTGATGTGGGAGTAAAGG - Intergenic
1101573872 12:105979885-105979907 GGCCAGTGCAGGGGCTGAGATGG + Intergenic
1101789090 12:107911797-107911819 GGCCAGTACTGTGGATGCGAGGG + Intergenic
1102733324 12:115134553-115134575 GACCAGTGCTGTGGGTGGGAAGG + Intergenic
1103161647 12:118734209-118734231 AAACAGTGCTGTGGCAGTGGTGG + Intergenic
1103465863 12:121141460-121141482 GGCCGGTACAGTGGCAGAGAAGG + Intronic
1104088031 12:125493645-125493667 TGCCAGTGCACTGGCATTGATGG + Intronic
1104245254 12:127033988-127034010 GGACAGGGCTTTGGCAGAGACGG + Intergenic
1104371596 12:128228505-128228527 GGCCAGTGTGGTAGGAGTGAGGG + Intergenic
1104374826 12:128255632-128255654 GGCCAGAGAGGTGCCAGTGAAGG + Intergenic
1104638201 12:130450823-130450845 GTCCTGTCCTGTGGCATTGATGG - Intronic
1104667467 12:130657619-130657641 GGGCTGTGCGGGGGCAGTGAGGG + Intronic
1104860286 12:131919859-131919881 AGCCAGGGCTGTGGCAGGGAGGG + Intronic
1104994045 12:132643066-132643088 TGGCAGTGCCGTGGCAGTGGTGG - Intronic
1105439443 13:20403149-20403171 GGCCAGGGCTGTGGAGGTGTTGG - Intergenic
1106201031 13:27537519-27537541 GGCCAGTGCTGTGGCACAGTGGG - Intergenic
1107557177 13:41527039-41527061 GGTCAGTGTTGGGGGAGTGATGG - Intergenic
1108290125 13:48951013-48951035 AACCACTGCAGTGGCAGTGAGGG + Intergenic
1109763358 13:66860469-66860491 ATCAAGTGCTGTGGCACTGACGG - Intronic
1111572198 13:90103631-90103653 GGCCACTGCTGGGGGGGTGAAGG + Intergenic
1112637083 13:101227081-101227103 TGCCTGTACTGTTGCAGTGAGGG + Intronic
1113311830 13:109140249-109140271 GGCCAGAGCTGCGGCAGGAAAGG - Exonic
1113420723 13:110169852-110169874 GTCCAGTGTTGTATCAGTGAGGG - Intronic
1113720783 13:112554410-112554432 GGCCTGCGGTGTGGCAGAGAAGG + Intronic
1113808152 13:113121895-113121917 GGCCAGTGCTGTGGGTGTTAGGG + Intergenic
1114274814 14:21133206-21133228 GGCTAGTGTTGTGGTAGGGAGGG + Intergenic
1114493691 14:23118728-23118750 CCCCAGGGCTGTGGCGGTGAAGG - Exonic
1114612730 14:24052872-24052894 GGTCAGGGTTGTGGCAGTGCTGG - Intronic
1114876873 14:26731339-26731361 GACCACTGCTCTGGCATTGAAGG - Intergenic
1115727138 14:36229417-36229439 GGCCAGTATTCTGGCAGTGGAGG - Intergenic
1116997515 14:51339457-51339479 GGCCAGTGCGGCTGCAGGGAAGG - Intergenic
1117376480 14:55122770-55122792 TGCCAGGGCTGTGGCAGGGTGGG - Intergenic
1120058073 14:79948856-79948878 GGGCAGTGCTGTGGGAGGAAGGG - Intergenic
1120188333 14:81417290-81417312 GGCCTGTGCTGTTGCAGAGCTGG - Intronic
1121005706 14:90489390-90489412 GCCCAGTGCTGGGACAGGGAAGG - Intergenic
1121142533 14:91555771-91555793 GGCCAGTTCTGTGCCATTGCTGG - Intergenic
1121195435 14:92067781-92067803 TGCCAGTGCTGTGTCAGTGGAGG - Intronic
1122463613 14:101916229-101916251 GGGCGGAGCTGTGGGAGTGAAGG + Intronic
1122649133 14:103216082-103216104 AGCCAATGCTGTGGCAGTCGGGG + Intergenic
1122748036 14:103911251-103911273 TGCCAGTGCAGTGGATGTGAAGG + Intergenic
1122919737 14:104875075-104875097 GCCCTGTGGTGGGGCAGTGATGG + Intronic
1122947461 14:105019348-105019370 GGCCACTGCTGCTGTAGTGAAGG - Intronic
1124721202 15:32112335-32112357 GGAGAGTTCTGTGGCAGAGATGG + Intronic
1125933570 15:43616590-43616612 CGCCCGTGCTCAGGCAGTGAAGG + Exonic
1125946668 15:43716052-43716074 CGCCCGTGCTCAGGCAGTGAAGG + Intergenic
1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG + Intronic
1126582160 15:50251969-50251991 GGGCAGCTCTGTGGTAGTGATGG - Intronic
1126850209 15:52791837-52791859 GGCCAAGGCTGTGGTAGTGGTGG + Intergenic
1127256112 15:57295159-57295181 GGCGAGAGGTGGGGCAGTGAGGG + Intronic
1128842911 15:70864523-70864545 GGCCAGAGCAGAGGGAGTGAGGG - Intronic
1130017808 15:80201279-80201301 TAGCAGTGGTGTGGCAGTGAGGG - Intergenic
1130332115 15:82930635-82930657 GGACAGTCATGTGGCAGTGGAGG + Intronic
1130555262 15:84918236-84918258 GGCCTGTGCTGTGGTAGGGTGGG - Intronic
1131091760 15:89629175-89629197 GGCCAGGGCTGTGGGGGTGGGGG + Intronic
1132895913 16:2229327-2229349 GGCCAGAGGTGTGAGAGTGACGG + Intronic
1132970769 16:2687618-2687640 CGCCAGGGCTGTGGCCGTGATGG + Intronic
1133239218 16:4404639-4404661 GGGATGTGCTGTGGCAGAGAGGG - Intronic
1134541447 16:15070048-15070070 GGTCAGTGTTGTGGGAGTGCTGG - Exonic
1134610883 16:15606994-15607016 GGCCAGGTCAGTGGCAGTGTTGG - Intronic
1135359439 16:21799628-21799650 GGTCAGTGTTGTGGGAGTGCTGG - Intergenic
1135436906 16:22434605-22434627 GGTCAGTGTTGTGGGAGTGCTGG - Intronic
1136263356 16:29097316-29097338 GGTCAGTGTTGTGGGAGTGCTGG + Intergenic
1136773269 16:32858791-32858813 GGCCAGTGCTGAGCCAGGAAAGG - Intergenic
1136897346 16:34002728-34002750 GGCCAGTGCTGAGCCAGGAAAGG + Intergenic
1137596281 16:49726110-49726132 GGCCTGTGCTGTGCCAGTCCTGG - Intronic
1140036815 16:71377559-71377581 GGCCAGTGGCGAGGCAGTGTGGG - Intronic
1141154532 16:81587955-81587977 GGCCAGCGCTGAGGCAGGAACGG + Intronic
1141943008 16:87290873-87290895 GCCCAGTGCTGGGGCAGAGATGG - Intronic
1203075691 16_KI270728v1_random:1120901-1120923 GGCCAGTGCTGAGCCAGGAAAGG - Intergenic
1142986916 17:3700974-3700996 GGGCCGTGGTGAGGCAGTGAGGG - Intergenic
1144576652 17:16433871-16433893 GGCCAGTCATGTGGCAGCCATGG - Intronic
1144577736 17:16439608-16439630 GGGCAGGGCTCTGGCAGTTACGG - Intergenic
1144712207 17:17409274-17409296 GCCCAGGGCTGGGGCAGGGAAGG - Intergenic
1144865829 17:18335182-18335204 GGCCTGGCCTGTGGCAGTGGAGG - Intronic
1145115428 17:20205750-20205772 GGCCAGTGCTGTGGAGCAGACGG + Exonic
1145780988 17:27563090-27563112 GACCAGGGAGGTGGCAGTGATGG - Intronic
1146122756 17:30209689-30209711 GGCCTTTGCAGTGGCAGTGTGGG + Intronic
1148615801 17:48998568-48998590 GGCGCGCGCGGTGGCAGTGAGGG + Intronic
1148645260 17:49216568-49216590 GGCCAGTGCCTGGGTAGTGAAGG - Exonic
1148872538 17:50667316-50667338 GGCCGGTGCAGTGGCACTGAGGG + Intronic
1149402484 17:56312532-56312554 GGCCAGAGATTTGGCAGTTAGGG - Intronic
1152427630 17:80226850-80226872 GCCCAGTGCTGTGGCCTGGAGGG + Intronic
1152639180 17:81442585-81442607 GGCCTGTGCCGTGGCAGGGGAGG + Exonic
1152879149 17:82805485-82805507 GGCCTGGGCGGTGGCAGTGGTGG + Intronic
1153503873 18:5775085-5775107 GCCAGGTGCTGGGGCAGTGAGGG - Intergenic
1154439281 18:14373266-14373288 TGGCAGTGATGTGGCAGTGGCGG - Intergenic
1155494586 18:26430007-26430029 GGCCACAGCTCTGCCAGTGATGG - Intergenic
1156379455 18:36544559-36544581 GGCAAGTCCAGAGGCAGTGAGGG - Intronic
1156833186 18:41520515-41520537 GGCCAGTGGTGTGCCACTTATGG + Intergenic
1157513441 18:48294764-48294786 CCCCAGGGCTGTGGCAGGGAAGG + Intronic
1157953324 18:52064787-52064809 GGCCAGGGAGGTGGCAGTGGAGG + Intergenic
1159891872 18:73960745-73960767 GGCTAGTACTGAGTCAGTGAGGG - Intergenic
1160258048 18:77264305-77264327 GGACAGTGCTGTCTCAGTCATGG + Intronic
1160433954 18:78831975-78831997 GGCCAGTTCAGTGGCTGAGAAGG - Intergenic
1160595795 18:79973247-79973269 GGTCACTGCTGAGGCCGTGAGGG - Exonic
1160731688 19:644170-644192 GGGCCGCGCTGTGGCCGTGAAGG + Intergenic
1160774267 19:847971-847993 GGCCAGCGCTGTGGGAGGGGCGG - Exonic
1161027555 19:2043471-2043493 GGCCAGTGCGGTGGCAAGGGTGG + Intronic
1161030621 19:2056311-2056333 GGTCTGGGCTGGGGCAGTGAGGG + Intergenic
1161218107 19:3104817-3104839 GGCCTGTGCTGTGGGGGTGCTGG + Intronic
1161299101 19:3534348-3534370 GGACAGTGCTGGGGGACTGAAGG - Intronic
1161979499 19:7623346-7623368 GGGCAGAGCTGTGGCTCTGAGGG + Intronic
1162084869 19:8242481-8242503 GGCCAGTGTTTTTGCAGGGAGGG - Intronic
1162113285 19:8413090-8413112 GGCCAGTGCTGGGGCGGAGCCGG + Intronic
1162185618 19:8902518-8902540 GGGCATTACTATGGCAGTGATGG - Intronic
1162460110 19:10809863-10809885 GGCCATGGGTGGGGCAGTGACGG + Intronic
1162724087 19:12679577-12679599 GGCCAGTTCAGTGGGAGTCAGGG - Intronic
1162935029 19:13977981-13978003 GGCCAGTGCCATGTAAGTGAAGG - Exonic
1164630739 19:29760084-29760106 GGCCTGTGCTGTGTGAGGGATGG + Intergenic
1164720078 19:30425528-30425550 GGCCAGTGCTGAGGAGGTGAAGG - Intronic
1165872279 19:38981313-38981335 GGCCAGGGCAGTGGCATTGCTGG + Intergenic
1166996626 19:46722626-46722648 CGCCAGTGCCCTGGCTGTGAGGG + Intronic
1168472941 19:56654481-56654503 GGCCAGGGTGGTGGTAGTGAAGG + Intronic
925162019 2:1692330-1692352 GGCCAGTGCTAAGGCAGTCATGG + Intronic
926409033 2:12582555-12582577 GGCCAAAGCAGTGGCAGTGATGG + Intergenic
926453967 2:13041081-13041103 GCCCAGTTCTGTGCCATTGAGGG - Intergenic
927046306 2:19282451-19282473 TGCCAGTGCTGTGGTATTGCAGG - Intergenic
928339909 2:30433908-30433930 GGCTAGTGTTCTGGCAGTGATGG - Intergenic
929054363 2:37863069-37863091 GGACAGTGCTGATGCAGTGGAGG - Intergenic
929292352 2:40207988-40208010 TTGCAGTGCTGTGGCTGTGAAGG - Intronic
929360718 2:41086395-41086417 GGCAAATGTTGAGGCAGTGATGG - Intergenic
933283134 2:80354804-80354826 GGCCCATACTCTGGCAGTGAGGG + Intronic
934574577 2:95391982-95392004 AGCCAGTGCTGCTGAAGTGAAGG + Intergenic
938328318 2:130428842-130428864 GCCCAGGGCTGTGGCGGTGGCGG - Intergenic
938361629 2:130692652-130692674 GCCCAGGGCTGTGGCGGTGGCGG + Intergenic
939103653 2:137924866-137924888 AGACAGTGATGTGGCAGTGGCGG + Intergenic
940398843 2:153223035-153223057 GGCCAGAGCTGCAGCAGGGAAGG - Intergenic
941416358 2:165226338-165226360 GGCCAGTGCATAGCCAGTGAAGG + Intergenic
943002832 2:182350759-182350781 GGCCAGAGCAGTGCCAGAGAAGG + Intronic
944098450 2:195995627-195995649 GACCAGTGGTGTGGGGGTGAAGG + Intronic
945020034 2:205561308-205561330 GCCCAGTACTGTGGCATTGCTGG - Intronic
945292089 2:208136746-208136768 GGCCATTGCTGGGGCAGTGCTGG - Intergenic
946063025 2:216961100-216961122 GGCCAGGGCTGGGGCGGGGATGG + Intergenic
947313899 2:228833786-228833808 GGTCAGTGCTGTTTCAGTGGAGG + Intergenic
947575828 2:231273466-231273488 GGGCAGTTCTGTGGAAGTCAGGG + Intronic
948068286 2:235098925-235098947 TGCCAGTGTTTTGGCAGTTAGGG + Intergenic
948094293 2:235321300-235321322 GGCCAGTGCGGGGGCTGTGGGGG + Intergenic
948139398 2:235661517-235661539 GGCCAGGGCTGTGGGGGTGGGGG + Intronic
948289692 2:236816032-236816054 GCCCAGTGCTTTGGCAGAGGTGG - Intergenic
1168896030 20:1324289-1324311 GGGCAGTGCCGTGGCGGGGAAGG - Intronic
1169017643 20:2304805-2304827 GGGCAGTGTTGTGGGACTGAGGG - Intronic
1169088876 20:2845156-2845178 GGCCAGTACTGGGGTGGTGATGG + Intronic
1169962274 20:11174574-11174596 GGCCAGTTCTGTGGCCATGCAGG + Intergenic
1170356326 20:15496014-15496036 GGCCAGTGTCGTTGCAGTGGAGG + Intronic
1170692611 20:18628919-18628941 GGCCAGTGATGCGGCAGTAAGGG + Intronic
1172751876 20:37256961-37256983 GCCCAGGGCTGGGCCAGTGAAGG - Intronic
1172826382 20:37790657-37790679 GGAAAGTGCTGTGGCAAAGAAGG + Intronic
1173545518 20:43894785-43894807 GGCCAGTGCTGAGGTAGGGGAGG + Intergenic
1174710147 20:52695812-52695834 GGCCAGTGCAGTGGCTGACAAGG - Intergenic
1175207883 20:57325846-57325868 AGCCAGTGCAGCTGCAGTGATGG + Intergenic
1175551302 20:59819697-59819719 GGCCAGTGCTGTCCCAGTACTGG + Intronic
1175561820 20:59937243-59937265 GGCCAGGGGCGTAGCAGTGAAGG + Exonic
1175732370 20:61362593-61362615 GGACAGTGTAGTGGAAGTGAAGG + Intronic
1176302054 21:5103052-5103074 GGCCTGTGCACTGGCAGTGGTGG + Intergenic
1176412626 21:6457341-6457363 GGCCCTGGCTGCGGCAGTGAGGG - Intergenic
1176456400 21:6916142-6916164 AGGCAGTGATGTGGCAGTGGCGG + Intergenic
1176834575 21:13781202-13781224 AGGCAGTGATGTGGCAGTGGCGG + Intergenic
1179245337 21:39628611-39628633 TGTCAGTGCTGTGTCAGAGATGG + Intronic
1179688120 21:43065663-43065685 GGCCCTGGCTGCGGCAGTGAGGG - Exonic
1179854975 21:44158848-44158870 GGCCTGTGCACTGGCAGTGGTGG - Intergenic
1180094444 21:45549613-45549635 GGGCAGTGATGTGGCAGGGGAGG + Intergenic
1180617487 22:17137998-17138020 GGGCAGTGCGGTGGAGGTGAGGG - Exonic
1181051324 22:20239526-20239548 GGCCTGTGCAGTGGCAGGGGTGG - Intergenic
1181138749 22:20788110-20788132 TGCCAGTGCTCTTTCAGTGAGGG + Intronic
1181293607 22:21817423-21817445 GGATAGTGCTGTGGCTGGGAAGG + Intronic
1181505709 22:23355353-23355375 GACAACTGCTGTGGTAGTGAAGG - Intergenic
1181876024 22:25941487-25941509 GGCCAGTGTTGCGCCACTGAAGG + Intronic
1182098655 22:27642560-27642582 GGCCAGGGATGTGGCTGAGAAGG - Intergenic
1182870217 22:33639829-33639851 GTGCAGTGCTGTTTCAGTGATGG - Intronic
1183265854 22:36824535-36824557 GGCGTGGGCTGTGCCAGTGATGG - Intergenic
1183335122 22:37241942-37241964 GGCCAGTGATGTGGGACAGAGGG + Intronic
1183641813 22:39097400-39097422 GGCCAGGGCTGAGGCACAGAAGG - Intronic
1183664834 22:39241328-39241350 GGCCAGTGCTGGGAGAGTCAGGG - Intronic
1184240122 22:43207448-43207470 GGCCAGGGCTGGGGCAGGGGCGG + Intronic
1184255063 22:43281827-43281849 GGACTGTGCCGTGACAGTGAAGG - Intronic
1184854999 22:47142042-47142064 GGCCAGAGCTGTGGCAGATGTGG - Intronic
950140771 3:10613663-10613685 GGCCAGGACAGTGGCAGTGGAGG - Intronic
950221811 3:11201888-11201910 GCCCAGGCCTGTGGCAGTGTTGG + Intronic
950538368 3:13594854-13594876 GGCCAGAGGGGTGGCAGGGAGGG + Intronic
950641469 3:14351237-14351259 GGCTAGGGCTGTGGCTGTGGAGG + Intergenic
951168188 3:19507262-19507284 AACCACTGCTGTGGCAATGACGG + Intronic
951654087 3:24985313-24985335 GGCAAATGCCATGGCAGTGATGG - Intergenic
952392307 3:32890981-32891003 GGCCTGAGCTTCGGCAGTGAGGG + Exonic
952541676 3:34373559-34373581 GGCCAGAGCTGTGGATGGGATGG + Intergenic
952884994 3:38006710-38006732 CACTAGTGCTGGGGCAGTGAGGG - Intronic
953213592 3:40897594-40897616 GGCCAGTGGTGTGCCATGGAAGG + Intergenic
953402659 3:42639430-42639452 ATCCAGTGCTGTGGAAGTTAAGG + Exonic
954130534 3:48558493-48558515 AGGCAGGGCTGTGGCAGGGAGGG - Intronic
954200997 3:49022949-49022971 GGGCATTGCTGTGGAAGTGCAGG + Exonic
954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG + Intronic
955205233 3:56889648-56889670 GGTCAGTGGTTTGGCAGTCAGGG - Intronic
955479442 3:59374576-59374598 GGCCTGTGGTGTGGCTCTGAAGG - Intergenic
957637195 3:82801688-82801710 GGCCAGTGTTGGGCGAGTGAAGG - Intergenic
958785655 3:98593787-98593809 GGACGGTGCTGTGGAAGGGACGG + Intergenic
959581105 3:107983472-107983494 AGGCACTTCTGTGGCAGTGACGG - Intergenic
960324040 3:116273210-116273232 ATCCAGTGCTGTGTCAGTCAAGG - Intronic
961017381 3:123478689-123478711 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017389 3:123478721-123478743 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017397 3:123478753-123478775 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017405 3:123478785-123478807 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017413 3:123478817-123478839 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017421 3:123478849-123478871 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017429 3:123478881-123478903 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017437 3:123478913-123478935 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017445 3:123478945-123478967 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017453 3:123478977-123478999 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017461 3:123479009-123479031 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017469 3:123479041-123479063 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961017477 3:123479073-123479095 GGACAGTGCTGGGGCAGGCAGGG + Intergenic
961450340 3:126999673-126999695 GGCCAGGGCTGTGGCGGTGATGG + Intronic
961504757 3:127362709-127362731 GGCCAGTCCTGTGGCAGGGAGGG - Intergenic
962620776 3:137176017-137176039 GGCCAGGGCGGTGGCACTCATGG + Intergenic
965231016 3:166052736-166052758 GGCTAGAGTTGTGGCAGTGTTGG - Intergenic
965386345 3:168050596-168050618 GGCCAGTGGATTGGCGGTGAAGG - Intronic
968531558 4:1094544-1094566 AGCCCCTGCTGTGGCAGTGTTGG - Intronic
968758046 4:2426947-2426969 CCCCAGGGCTGTGGCAGTGAGGG + Intronic
969113921 4:4859863-4859885 GGCCAGTGCTGCGGCAGAAGGGG + Exonic
969218806 4:5746059-5746081 GGCCAGTGGTGGGGCAGAGATGG + Intronic
969444930 4:7239306-7239328 GGGCAGGGCTGTGGCCGGGAGGG + Intronic
969544978 4:7820075-7820097 GGACATTGCTGTAGCAGTGCAGG + Intronic
970538377 4:17053091-17053113 GACCAGTGAGGAGGCAGTGAAGG + Intergenic
970562559 4:17297009-17297031 TGCCTGTGCTGTGGCTCTGAAGG - Intergenic
971891492 4:32529547-32529569 GGCCAGTGGTGGGGGAGGGATGG - Intergenic
972351865 4:38243540-38243562 AGCCAGGGCTGTGGCTGTGAAGG + Intergenic
980681576 4:136169131-136169153 ATTCAGTGCTGTGTCAGTGAAGG - Intergenic
982095568 4:151918887-151918909 GCCAAGGGCTGTGGCAGTGTGGG + Intergenic
982126843 4:152191091-152191113 GACCTGCGCAGTGGCAGTGAGGG + Intergenic
984499081 4:180535625-180535647 AGCCAGTTCTGTAGCAGGGATGG + Intergenic
985780653 5:1869195-1869217 GGCCAGTGCTGTTGCAAAGCTGG + Intergenic
985990920 5:3560585-3560607 GCCCAGTGTTGTGGGAGTGGAGG - Intergenic
986033309 5:3913539-3913561 GACCAGTGCTGTGGAATAGAAGG + Intergenic
988705555 5:33723042-33723064 GGACAGTGCTGTGGCCCTGATGG + Intronic
991018847 5:61959267-61959289 GGCCAGTGCAGTAGGAATGAGGG - Intergenic
995851715 5:116553349-116553371 CGCCAGAGCTGTGGTTGTGATGG - Intronic
996576715 5:124983849-124983871 GCCCAGTGGTGTGGCAGAAAAGG + Intergenic
997260616 5:132463174-132463196 GGCCAGGCCTATGGCAGTGGAGG - Exonic
997365659 5:133323655-133323677 GGCCAGCCCTGTGGCATGGAGGG - Intronic
997663111 5:135604452-135604474 GGCCAGTCCTGGGGCACTGAGGG + Intergenic
997845809 5:137284813-137284835 GGCAAGTTCTGTGACTGTGAGGG + Intronic
997878001 5:137566153-137566175 GGCCAGAGCCCTGGGAGTGAGGG - Intronic
998426963 5:142036997-142037019 GCCCAGTGCTGGGTCAGAGAAGG - Intergenic
998623898 5:143823969-143823991 GGGCAGTGCTGGGGAAGAGAGGG + Intergenic
999081532 5:148848772-148848794 GCACAGTGCTGTGACAGTGCTGG + Intergenic
999148230 5:149409789-149409811 GGGCTGTGGTGTGGCTGTGAGGG - Intergenic
999186037 5:149709691-149709713 GACCAGGGCTGTGGCAGTGGAGG + Intergenic
999712671 5:154332305-154332327 GGCCACAGCAGTGGCAGTGAGGG + Intronic
999972439 5:156878557-156878579 GGCCAGTGGTGTGGTCATGATGG + Intergenic
1001919870 5:175591326-175591348 GGCCACTGGTGAGGCGGTGAGGG - Intergenic
1002088248 5:176789440-176789462 TGCCAGTGGTGTGGCAGCCACGG + Intergenic
1003037765 6:2659968-2659990 GGCCAGTCCTCTGGAAGGGATGG + Intergenic
1003386643 6:5673593-5673615 TGCCAGCTCTGTGGAAGTGAGGG + Intronic
1006417550 6:33913572-33913594 GGGCCCTGATGTGGCAGTGATGG - Intergenic
1007477560 6:42129065-42129087 GACCATTGCTGTGGGAGAGAAGG - Intronic
1007756458 6:44102754-44102776 GGCCTGGGCTGAGGCAGGGAGGG - Intergenic
1007764405 6:44152385-44152407 GGTCAGGGCGGTTGCAGTGATGG - Intronic
1009818163 6:68763780-68763802 GGCCGGTGCGGTGGCGGTGGTGG + Intronic
1011612070 6:89162143-89162165 GGCCAAAGCTCTGGCAATGACGG + Exonic
1013035484 6:106378396-106378418 GCCCTGAGCAGTGGCAGTGATGG - Intergenic
1013425870 6:110012134-110012156 GGCCAGTGAGGTGGGAGAGAGGG - Intergenic
1013491513 6:110650898-110650920 GGCCTGTGCTTTGGCAGTTGGGG + Intronic
1013810859 6:114042801-114042823 GACCAGACCTGAGGCAGTGAAGG - Intergenic
1015497032 6:133892960-133892982 GGGCTGCGCTGGGGCAGTGAGGG - Exonic
1016311603 6:142739303-142739325 GGGCAGTGCTGTGTCAATGAAGG - Intergenic
1018079666 6:160247918-160247940 GGCTGCTGCTGTGGCAGTTATGG + Intronic
1018273347 6:162103974-162103996 AGCCTGTGCTGTGGAGGTGAGGG + Intronic
1018425289 6:163674300-163674322 GCACAGTGCTGTGACAGTGTAGG + Intergenic
1018593268 6:165451567-165451589 GGCCAGGGTTGTGACAGTGAGGG - Intronic
1018866687 6:167751921-167751943 GGCCAGTGGTTTGGCAAAGAAGG - Intergenic
1019332706 7:468547-468569 TGACAGTGATGTGGCAGTGGTGG - Intergenic
1019615161 7:1956140-1956162 GCCCAGGGCTGTGCCATTGAAGG - Intronic
1019752350 7:2739276-2739298 GGCCAGGGCAGTGGGAGTGGCGG - Intronic
1020997095 7:15278772-15278794 GGCAATTGCTGTGGCAGCCAAGG + Intronic
1022112823 7:27241763-27241785 GGCCCCTGCTGTGGCAGTACTGG - Intergenic
1023057773 7:36303558-36303580 GGCCAGTGGTGTGACACTGCAGG + Intergenic
1023282425 7:38584771-38584793 GGTCTCTGCTGAGGCAGTGATGG - Intronic
1023324895 7:39043471-39043493 GGCAAGTGCTGTTGCAGTAATGG + Intronic
1027162333 7:75811837-75811859 GGCCAGGGCAGTGGCTGTCAAGG - Exonic
1028215754 7:88130791-88130813 GCCTGGTGCTGTGGCAGTGATGG + Intronic
1030942032 7:115663335-115663357 GGCCTGTGCACTGGCAGTGAGGG + Intergenic
1031863440 7:127010218-127010240 GGCCAGTTCTGTTGCCTTGAGGG - Intronic
1032080802 7:128857546-128857568 GGCCAGAGCTGAAGGAGTGAGGG - Intronic
1032091451 7:128913614-128913636 GGCCAGAGCTGAAGGAGTGAGGG + Intergenic
1033548374 7:142423091-142423113 AGCCTATACTGTGGCAGTGATGG + Intergenic
1034412366 7:150948059-150948081 TGCCAGTGCTTGGGCAGTCAGGG - Intronic
1034517178 7:151590144-151590166 GGCCAGTGCAGTGGCCATGTGGG - Intronic
1034965322 7:155387230-155387252 GGGCTGTGCTGTGGGGGTGAGGG + Intronic
1035170814 7:157016634-157016656 TCCCAGAGCTGTGGCAGTGGGGG + Intergenic
1036962621 8:13261622-13261644 GCCCAGGGTGGTGGCAGTGAGGG + Intronic
1037820431 8:22132376-22132398 GGCCAGTTCTGTGGCAAGGCAGG + Intronic
1041401542 8:57450538-57450560 CCCCAGTGCTGTGCCTGTGATGG + Intergenic
1042993517 8:74667270-74667292 GAGCAGGGCTGTGGCAGTAAGGG + Intronic
1043143109 8:76616211-76616233 GGCTAGTGCTGCGGCTGTGTTGG - Intergenic
1043477436 8:80619099-80619121 GAGCAGTGCAGTGGCAGGGAAGG + Intergenic
1044187272 8:89269070-89269092 GTCCAGCACTGTGGCAGTGTTGG - Intergenic
1045062499 8:98422044-98422066 GGCCAGCGATGAGGCAGAGAAGG - Intronic
1046885379 8:119361256-119361278 ATCCAGTTCTGTGGCAGCGAAGG - Intergenic
1049622518 8:143605044-143605066 GGCCAGGTCTGCGGCAGTGCTGG - Exonic
1053130661 9:35613339-35613361 GGCCAGTGCTGGAGGAGTGGAGG - Intronic
1055080476 9:72263903-72263925 GCCCACTGCAGTGGCAGTGGAGG + Intergenic
1055235278 9:74114852-74114874 GGCCAGACATGTGGCTGTGATGG - Intergenic
1056791513 9:89628242-89628264 GGCCCATGCTGTGGCACAGATGG + Intergenic
1056837375 9:89967640-89967662 GTCCTGTGTTGTGGCAGTGAGGG + Intergenic
1057519703 9:95751531-95751553 GGCCTGAGCTGTGGGAGGGAGGG + Intergenic
1059011540 9:110466961-110466983 GGCCAGTACTCTGGGAGTCAGGG - Intronic
1059189516 9:112311163-112311185 GGCCAGGGCAGTTGCAGTTATGG + Intronic
1060184125 9:121553487-121553509 GGCCAGGGCTGAAGTAGTGATGG - Intergenic
1061129941 9:128703051-128703073 GGCCAGGGCAGGGGCAGGGAAGG - Intronic
1061890134 9:133614958-133614980 GGCCAGTGCTGTGTCACCCAGGG + Intergenic
1062044026 9:134416992-134417014 GGCCAGGCCTGGGGCAGAGATGG + Intronic
1062240505 9:135535081-135535103 GGCCAGCTGTGTGGCAGTTATGG + Intergenic
1062263961 9:135678327-135678349 GGCTGGGGCTGGGGCAGTGACGG + Intergenic
1062309434 9:135928199-135928221 AGCCAGTGCTGTGGGCGGGAAGG + Intergenic
1062323303 9:136001054-136001076 GGCCCCTGCTGGGGAAGTGATGG + Intergenic
1062546414 9:137065501-137065523 GGACAGGGCTGTGGCACTCACGG + Exonic
1186411000 X:9344244-9344266 GGGCAGTGCTTTGGGAGAGAGGG - Intergenic
1188810066 X:34642774-34642796 GGCCAGAACAGTGGCAGTCATGG - Intronic
1191119124 X:56884820-56884842 GGCCAGTGCTGGGGGAGGGGTGG - Intergenic
1192796045 X:74424515-74424537 CACCAGTGCTGTGGCACAGACGG - Intronic
1193350211 X:80455089-80455111 GGGCAATGCTGTGTCAGTGTAGG - Intergenic
1195945176 X:110202296-110202318 AGACATTGCAGTGGCAGTGATGG + Intronic
1198393098 X:136196177-136196199 GGCCAGTGAGGTGGGAGTGAGGG + Intronic
1199852941 X:151738313-151738335 AGGCACTGCTGTGGCAGTCAGGG - Intergenic
1200089556 X:153627951-153627973 GGCCGGGGCTGGGGCAGCGAGGG + Intergenic
1200155731 X:153973964-153973986 GGCCAGTGCTGTTGAGGTGTTGG + Intronic