ID: 917797520

View in Genome Browser
Species Human (GRCh38)
Location 1:178542714-178542736
Sequence GGGGTACTGACTGGGCAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917797520_917797526 -1 Left 917797520 1:178542714-178542736 CCGCGCTGCCCAGTCAGTACCCC 0: 1
1: 0
2: 2
3: 28
4: 326
Right 917797526 1:178542736-178542758 CGACGCCCCCGCGCCCCCGCCGG 0: 1
1: 0
2: 2
3: 40
4: 244
917797520_917797527 0 Left 917797520 1:178542714-178542736 CCGCGCTGCCCAGTCAGTACCCC 0: 1
1: 0
2: 2
3: 28
4: 326
Right 917797527 1:178542737-178542759 GACGCCCCCGCGCCCCCGCCGGG 0: 1
1: 1
2: 6
3: 55
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917797520 Original CRISPR GGGGTACTGACTGGGCAGCG CGG (reversed) Intronic
900555504 1:3278388-3278410 GGGGTCCTGCCTGTGCAGTGGGG - Intronic
900719107 1:4163696-4163718 GGGGCACTGCCTGGGGAGCCTGG - Intergenic
901223901 1:7601012-7601034 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
901271183 1:7953345-7953367 GGGGTCCTGGCCGGGCAGAGGGG - Intergenic
903265634 1:22156424-22156446 GGGGTGGGGACTGGGCAGGGAGG - Intergenic
903508267 1:23853528-23853550 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
903921543 1:26803885-26803907 GGGCTCCTGGCTGGGCAGAGGGG + Intergenic
903953187 1:27008278-27008300 TGGGTGCTGACTTGGCAGCAAGG - Intronic
904784726 1:32974919-32974941 GGGCGACTGGCTGGGCAGAGGGG + Intergenic
906036130 1:42751033-42751055 GGGGTCGTGGCTGGGCAGAGGGG - Intronic
907216533 1:52869774-52869796 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
909147394 1:71953719-71953741 GGCTTACTGACTGGTCAGAGTGG - Intronic
909482694 1:76142555-76142577 TGGCTCCTGACTGGGCAGGGAGG + Intronic
911325777 1:96469625-96469647 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
911486459 1:98512313-98512335 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
912862465 1:113226240-113226262 CGGGCACTGACTGGGAAGGGAGG - Intergenic
913528167 1:119713145-119713167 GAGGTAGAGACTGGGCAGCTGGG - Intronic
914987286 1:152471934-152471956 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
917797520 1:178542714-178542736 GGGGTACTGACTGGGCAGCGCGG - Intronic
918818895 1:189226037-189226059 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
920143845 1:203841683-203841705 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
920381213 1:205535542-205535564 GGGGAACTGCCTGGTCAGGGAGG + Intergenic
920749388 1:208659466-208659488 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
920795112 1:209129667-209129689 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
921709746 1:218361967-218361989 GGGGCTCTGACTGGCCAGTGTGG - Intronic
922437843 1:225623874-225623896 CGGGTACTGACTGGGCCCGGTGG - Intronic
922804224 1:228377383-228377405 GGGGCACTGGCTGTGCAGAGGGG - Intronic
922811303 1:228416850-228416872 CGGGTGCTGACTGGGCGGTGGGG + Intronic
923524852 1:234764595-234764617 GGGGTACTGACTGGCCAGAGTGG - Intergenic
924283732 1:242464024-242464046 GGGGTTTGGACTTGGCAGCGTGG - Intronic
1063962836 10:11321318-11321340 GCTGTACAGAGTGGGCAGCGCGG - Exonic
1064000665 10:11661504-11661526 GGGGTAATGAGTGGGGAGTGAGG - Intergenic
1064115190 10:12571624-12571646 GGGGAACAGAATAGGCAGCGAGG - Intronic
1064179133 10:13100013-13100035 GGGGTATGGAATGGGCAGGGTGG + Intronic
1065219632 10:23482950-23482972 AGGGTACTGGCTGGGCATGGTGG - Intergenic
1065594167 10:27296091-27296113 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1067331933 10:45330610-45330632 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1068005865 10:51392661-51392683 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1068628433 10:59274447-59274469 GGGAGACTGACTGAGCAGTGAGG + Intronic
1071616733 10:87081411-87081433 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1073098172 10:100993107-100993129 GGGGGGCTGACAGGGCAGGGAGG - Intronic
1074445637 10:113519094-113519116 GGGCTACTGAATGGGAAGTGCGG + Intergenic
1076699733 10:132265214-132265236 GGGGAGCTGCCAGGGCAGCGAGG + Intronic
1076723273 10:132401970-132401992 GGGGTGCGGCCTGGGCAGGGCGG + Intronic
1077234622 11:1473989-1474011 GGGGCAGTGTCTGGGCAGTGAGG - Intronic
1079285127 11:19122311-19122333 GGGGTACTGACTTGTCAGATTGG + Intronic
1080098393 11:28431244-28431266 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1082244993 11:49911623-49911645 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1082844449 11:57716112-57716134 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1083662865 11:64259898-64259920 GGGGTACTCTCAGGGCAGTGTGG - Intronic
1084037444 11:66521200-66521222 GAGTTACTGACAGGGCAGGGAGG + Intronic
1084148695 11:67278244-67278266 GGGGCACTGCCTGGGCACCTGGG - Intronic
1084321342 11:68375110-68375132 AGGGTTCTGTCTGGGCAACGTGG - Intronic
1084338295 11:68475443-68475465 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1084961075 11:72717028-72717050 TTGCTACTGACTGGGCTGCGGGG - Intronic
1085116633 11:73936664-73936686 GGGCTCCTGGCTGGGCAGAGGGG + Intergenic
1085359842 11:75877379-75877401 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1085466629 11:76728464-76728486 GCTGTACTCACTGGGCAGGGGGG + Intergenic
1085754535 11:79192033-79192055 GGGCTCCTGGCTGGGCAGAGGGG - Intronic
1086881768 11:92158374-92158396 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1088820554 11:113452937-113452959 GGGATAGTGGCTGGGCAGGGTGG - Intronic
1092242806 12:6845855-6845877 GGGGTACAGAATGGGGAGGGAGG - Intronic
1092827797 12:12414587-12414609 GGGCGACTGGCTGGGCAGAGGGG + Intronic
1093055622 12:14553182-14553204 GGGATACTTACGGGGCAGTGAGG + Exonic
1094103595 12:26785917-26785939 GGGGTCCTGGCCGGGCAGAGGGG - Intronic
1094488652 12:30945045-30945067 GGGGGAATGGCTGGGCAGCATGG - Intronic
1094716882 12:33022699-33022721 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1096082468 12:48842360-48842382 GGGCGGCTGACTGGGCAGAGAGG - Intronic
1098019267 12:66135526-66135548 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1098884048 12:75942577-75942599 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1100003639 12:89867626-89867648 GGGGTCGTGGCTGGGCAGAGGGG + Intergenic
1100838535 12:98589824-98589846 GGGGTTCTGGCTGGGCATGGTGG - Intergenic
1100851260 12:98714158-98714180 GTGGTACTGACTTGGCATCAAGG - Intronic
1101317685 12:103643996-103644018 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1101960980 12:109249890-109249912 AAGGGACTGACTGGGCAGCAAGG - Intronic
1103591259 12:121993758-121993780 GGGGTGCTGGCCGGGCAGAGGGG - Intronic
1103591339 12:121993935-121993957 GGGGTGCTGGCCGGGCAGAGGGG - Intronic
1107133568 13:36920504-36920526 GGGGGACCGAGAGGGCAGCGCGG - Intronic
1107597802 13:41981072-41981094 AGGGTCCTGAATGGGCAGCAGGG + Intergenic
1111186034 13:84736923-84736945 GGGGTCCTGGCTGGGCACAGTGG - Intergenic
1113137443 13:107108484-107108506 TGGCTACTGACTAGTCAGCGTGG + Intergenic
1113337750 13:109393268-109393290 GGGGTAATGACTGAGGAGAGAGG - Intergenic
1113576095 13:111396283-111396305 GGGGGACTGAGTAGGCAGAGAGG - Intergenic
1114186165 14:20404059-20404081 GAGGTCCTGGCTGGGCAGGGTGG + Intronic
1114199517 14:20507078-20507100 GGGGTCCTGGCCGGGCAGAGGGG - Intronic
1115504359 14:34079252-34079274 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1116841336 14:49821773-49821795 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1117301293 14:54431023-54431045 GGAGAACAGACTGGGCAACGTGG - Intronic
1117518126 14:56523013-56523035 GGGGCACAGCCTGGGCATCGAGG + Intronic
1118056970 14:62089028-62089050 GGGGTACTGGCTGGGCTTGGTGG + Intronic
1118159071 14:63270837-63270859 GGACAACTGACTGGGCAGCAGGG - Intronic
1119530233 14:75354924-75354946 GGGGTACAGAGTGGGCAGGCAGG + Intergenic
1119798011 14:77416732-77416754 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1122406918 14:101506230-101506252 GGGGTATTGCCTGGACAGCAAGG - Intergenic
1122902080 14:104786149-104786171 GGGGTCCTGAGTAGGCAGGGTGG - Intronic
1202848159 14_GL000009v2_random:200271-200293 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1123968336 15:25480902-25480924 GGGGTCCAGCCTGGGCAGAGGGG + Intergenic
1124846737 15:33298866-33298888 GGGATTCTGACTGGGCTGCAGGG + Intergenic
1127284112 15:57517691-57517713 GGGGAACTGACTGGCCAGAGGGG + Intronic
1128804313 15:70519207-70519229 TGGGGACTCACTGGGCAGCGGGG + Intergenic
1130256330 15:82327683-82327705 CGGGTACAAAGTGGGCAGCGTGG - Intergenic
1130598622 15:85262305-85262327 CGGGTACAAAGTGGGCAGCGTGG + Intergenic
1130677746 15:85968542-85968564 GGGGTTCTGAGTGGGAAGGGGGG - Intergenic
1131043745 15:89296724-89296746 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1132597554 16:760347-760369 GGAGTCCTGTCTGGGCTGCGTGG + Intronic
1132622517 16:874500-874522 GGGGTGCTGGCTGGGCGGCCGGG + Intronic
1132679122 16:1132570-1132592 CGGGAACTGACTAGCCAGCGAGG + Intergenic
1135948171 16:26884148-26884170 AGGGTACTGGCTGGGCATGGTGG + Intergenic
1136086097 16:27886150-27886172 GGGGTAATGGCTGGGCACGGTGG + Intronic
1136363316 16:29795981-29796003 GAGGTACAGGCTGGGCAGGGTGG + Intronic
1136519619 16:30787102-30787124 GGGGGACGGACTGGGCGCCGAGG + Exonic
1136574699 16:31116627-31116649 GGGGCACTGGCTGGGCACGGTGG + Intronic
1137240718 16:46653190-46653212 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1137734829 16:50716068-50716090 GGGTTAAGGACTGGGCAGCAGGG + Intronic
1138043675 16:53698853-53698875 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1138884786 16:61063535-61063557 GGGGTACAGACTGGGCATGGTGG + Intergenic
1139186004 16:64807072-64807094 GGAGTACTCACTGGACAGCTTGG + Intergenic
1141068206 16:80931049-80931071 GGGGTACAGACCGGGCACAGTGG + Intergenic
1141710136 16:85694008-85694030 GGGGTACAGGCTGGGCATGGTGG - Intronic
1141728711 16:85808142-85808164 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1142189229 16:88710033-88710055 GGGGGTCTGACTGAGCAGCCTGG + Intronic
1142266580 16:89066754-89066776 GGTGTCCTGACTGAGCAGCCGGG + Intergenic
1142789882 17:2255649-2255671 GGGGTAGTGGCCGGGCAGAGGGG - Intronic
1142998253 17:3774131-3774153 GGGTTCCTGGCTGGGCAGGGCGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145886405 17:28385106-28385128 GGCGGACTGGCTGGGCAGCCTGG + Exonic
1146290242 17:31601556-31601578 GCGGCACTGACTGGGCAGAAGGG - Intergenic
1147153812 17:38533264-38533286 GGGGGACAGGCGGGGCAGCGGGG + Exonic
1147181064 17:38686027-38686049 GGTGGACTGAGTGGGCAGTGTGG - Intergenic
1147625530 17:41897469-41897491 GGGGTGTGGACTGGGCAGGGAGG - Intronic
1147848238 17:43420506-43420528 GAGGTACTGGCTGGGCACGGTGG + Intergenic
1149211783 17:54311758-54311780 GGGGGACAGAGTGGGCAGAGGGG + Intergenic
1149467919 17:56894023-56894045 GGGGGACAGCCTGGGCATCGGGG + Intronic
1149500471 17:57148558-57148580 GGGGTACTGACTTTGAAGGGGGG - Intergenic
1149991401 17:61385552-61385574 GGGTTCCTGAATGGGCAGTGAGG - Intronic
1151432268 17:74071545-74071567 GGGGAAGTGCCTTGGCAGCGTGG + Intergenic
1151801737 17:76383314-76383336 GGGGCACTGGCTGGGACGCGGGG - Intronic
1152151363 17:78603424-78603446 GGGGTACTGAGAGGGGAGGGAGG - Intergenic
1154278077 18:12979598-12979620 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1154416361 18:14177941-14177963 GGGGTGCTGACTGGGGTGGGGGG + Intergenic
1155001750 18:21694382-21694404 GTGGTACTGGCTGGGCACAGTGG - Intronic
1158202685 18:54958285-54958307 GGGGAAGAGAGTGGGCAGCGGGG + Intronic
1160038193 18:75320551-75320573 GTGGGAATGACTGGGCAGGGCGG + Intergenic
1160726074 19:618375-618397 GGGGCAGGGACTGGGCAGAGTGG - Intronic
1160788368 19:912188-912210 GGGGGACTGACCGGGGAGTGGGG + Intronic
1160916442 19:1499143-1499165 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1161511699 19:4675713-4675735 GGGGTCCACACCGGGCAGCGGGG - Exonic
1161790372 19:6355936-6355958 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1163105543 19:15121015-15121037 GAGGGACTGACTGGGAAGCCAGG + Intronic
1163341210 19:16708385-16708407 GGGGTCTTGGCTGGGCAGGGTGG - Intergenic
1163649648 19:18509807-18509829 GGGGCACTGGCTGGGCGGGGGGG - Intronic
1165511438 19:36268785-36268807 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165511986 19:36271308-36271330 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165512536 19:36273809-36273831 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165513085 19:36276350-36276372 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165513641 19:36278905-36278927 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165514191 19:36281439-36281461 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165514743 19:36283976-36283998 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165515295 19:36286509-36286531 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165515845 19:36289045-36289067 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165516396 19:36291582-36291604 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165516948 19:36294108-36294130 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165517501 19:36296631-36296653 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165518053 19:36299166-36299188 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165518604 19:36301701-36301723 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165519153 19:36304233-36304255 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165519703 19:36306748-36306770 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1165520252 19:36309276-36309298 GGGGTGCCGGCTGGGCTGCGCGG - Intergenic
1166007445 19:39917145-39917167 GGGGTGCTTACTGGGCAGTGGGG + Intronic
1166708983 19:44925239-44925261 GGGCTACTGACTGGGCGCAGTGG - Intergenic
1167712303 19:51119902-51119924 GGGGTCCTGAGCGGGGAGCGGGG + Intergenic
926389785 2:12377530-12377552 AGGGTATTGACTGGGCACAGTGG + Intergenic
927498160 2:23564354-23564376 GGGGCAAGGACTGGGCAGGGTGG + Intronic
927897680 2:26795229-26795251 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
929110821 2:38403845-38403867 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
929314166 2:40457465-40457487 GGGCTACTGTCTGGGCATTGTGG - Intronic
929923217 2:46188455-46188477 GGAGCACAGACTGGCCAGCGGGG + Intergenic
930208760 2:48614511-48614533 GGGCTCCTGGCTGGGCAGAGGGG + Intronic
930655846 2:54006574-54006596 GAGATACTGACTGGGCACAGCGG - Intronic
930827161 2:55705876-55705898 GGGGTGCTGGCCGGGCAGAGGGG - Intergenic
931271750 2:60709532-60709554 GGGGTTTTGACTGGGCAACAGGG - Intergenic
931584342 2:63809376-63809398 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
931752146 2:65339190-65339212 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
932434789 2:71696652-71696674 GGGGTTCAGAGTGGGCAGTGAGG - Intergenic
932732653 2:74232028-74232050 GGGCCACAGACTGGGGAGCGGGG + Intronic
936017451 2:108970535-108970557 GGGAGCCTGACTGGGCAGGGAGG + Intronic
937295397 2:120807047-120807069 GTGGGACTGACTGAGCAGCCAGG - Intronic
937454785 2:122031866-122031888 GGAGTACTGCCTGGGCAAAGGGG + Intergenic
938250101 2:129808078-129808100 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
939584854 2:143991998-143992020 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
945090306 2:206171640-206171662 GGGCTCCTGGCTGGGCAGAGGGG + Intergenic
946407180 2:219497946-219497968 GGGGCGGGGACTGGGCAGCGAGG + Intronic
948356468 2:237381706-237381728 AAAGTACTGACTGGGCAGGGTGG - Intronic
948651603 2:239449458-239449480 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
948706466 2:239796082-239796104 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1169189053 20:3645656-3645678 GGGGTACAGAAGGGGCAGCAAGG - Intronic
1170367773 20:15616389-15616411 GGGGAACTGGCTGGGCACGGTGG - Intronic
1170623933 20:18016744-18016766 GTAGTACTGGCTGGGCACCGTGG - Intronic
1172132521 20:32665058-32665080 GGGGAACTTACTTGGCAGCTTGG - Intergenic
1172349205 20:34229114-34229136 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1172733596 20:37109245-37109267 GGGATACTGACTGGGCGCGGTGG + Intronic
1172819278 20:37718137-37718159 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1173460988 20:43243273-43243295 GGGACACCCACTGGGCAGCGAGG + Intergenic
1174327217 20:49789044-49789066 GGGGTGCTGATTGGCCAGCATGG - Intergenic
1176120757 20:63453557-63453579 GGGCTCCTGACTGGGAAGCCAGG - Intronic
1176308826 21:5138921-5138943 GGGGTCCTGGCTGGGCTGTGAGG - Intronic
1176705884 21:10119795-10119817 GGGGTGCCGGCTGGGCTGCGCGG + Intergenic
1178106857 21:29329018-29329040 GGAGTACAGACTGGGCACAGTGG + Intronic
1179195265 21:39157544-39157566 GGGCTCCTGGCTGGGCAGAGGGG - Intergenic
1179848236 21:44123112-44123134 GGGGTCCTGGCTGGGCTGTGAGG + Intronic
1180086617 21:45510514-45510536 GGGGCACTGCCGGGGGAGCGGGG - Intronic
1181792256 22:25277663-25277685 GGGGTGGTGGCCGGGCAGCGGGG + Intergenic
1182092203 22:27603519-27603541 GGGGCACTGTCTGGGCACTGTGG - Intergenic
1182712447 22:32331406-32331428 GGGGAGCTGACTGGGGCGCGAGG - Intergenic
1182772404 22:32804847-32804869 GGGGCAATGACTGGCCAGGGAGG - Intronic
1183434788 22:37787064-37787086 GGGGTGCTGGCCGGGCAGAGGGG - Intergenic
1183452919 22:37906417-37906439 GGGGTCATGGCTGGGCCGCGGGG + Exonic
1183746296 22:39693979-39694001 GGGGCTCTGCCTGGGCAGAGCGG + Intergenic
1183995599 22:41630992-41631014 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1183996970 22:41641586-41641608 GGGGTAGTGATGGGGCAGTGGGG - Intronic
1185173536 22:49306752-49306774 GGGGTTCTGGCTTGGCAGTGAGG - Intergenic
950656407 3:14439723-14439745 TGAGTACTCACTGCGCAGCGGGG + Intronic
950819637 3:15742840-15742862 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
951290352 3:20866687-20866709 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
955362773 3:58289765-58289787 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
959586037 3:108026195-108026217 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
959683941 3:109124594-109124616 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
960029944 3:113046347-113046369 GGGCTGCTGGCTGGGCAGAGGGG + Intergenic
960052020 3:113248130-113248152 GGGGTGCTCATTGGGCAGTGTGG + Intronic
960866024 3:122201530-122201552 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
961523058 3:127479120-127479142 GGGGTTCTGAGGGGTCAGCGGGG - Intergenic
961729739 3:128955639-128955661 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
961909780 3:130302522-130302544 GTGGTACTGGTTGGGCAGCAGGG - Intergenic
963498614 3:146097263-146097285 GGGGTCGTGGCTGGGCAGAGGGG - Intronic
964291596 3:155186909-155186931 GGGGTACTGGCTGGGCAGAGTGG - Intergenic
964674147 3:159258803-159258825 GGGGCACAGACTGGGCAGTGTGG - Intronic
966617167 3:181925834-181925856 GGGGTGGTGGCTGGGCAGAGAGG + Intergenic
968316678 3:197731524-197731546 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
968616925 4:1581251-1581273 GGGGCTCTGAGTGGGAAGCGGGG - Intergenic
969604161 4:8194036-8194058 GGGGTGCTGGCTGGGGAGCAGGG - Intronic
970409642 4:15791889-15791911 GGGGTCCTGGCCGGGCAGAGGGG - Intronic
976265540 4:83185135-83185157 GGGGTCGTGGCTGGGCAGAGGGG + Intergenic
979622635 4:122812659-122812681 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
979641375 4:123015714-123015736 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
980354497 4:131724746-131724768 GGGGTGCTGGCTTGGCTGCGCGG - Intergenic
980355030 4:131727252-131727274 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980355577 4:131729739-131729761 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980356122 4:131732230-131732252 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980356654 4:131734718-131734740 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980357193 4:131737206-131737228 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980357735 4:131739701-131739723 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980358271 4:131742187-131742209 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980358805 4:131744681-131744703 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980359345 4:131747154-131747176 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980359888 4:131749622-131749644 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980360428 4:131752117-131752139 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980360969 4:131754589-131754611 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980361511 4:131757072-131757094 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980362052 4:131759544-131759566 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980362594 4:131762027-131762049 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980363137 4:131764506-131764528 GGGGTGCTGGCTGGGCTGCGCGG - Intergenic
980371815 4:131883514-131883536 TGGGTCCTGAGTTGGCAGCGGGG - Intergenic
980378145 4:131976482-131976504 GGGGTGCTGGCTGGGCTGCGCGG + Intergenic
981122992 4:141073874-141073896 GGGGAATGGACTGGGGAGCGGGG + Intronic
981323350 4:143418027-143418049 GGGCTGCTGACTGGCCAGAGAGG - Intronic
981677611 4:147358375-147358397 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
982161417 4:152573725-152573747 AGGGTCCTGACTGGGCAAGGAGG + Intergenic
982191944 4:152866398-152866420 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
982344501 4:154342297-154342319 TGGGTACTAACTGGTCAGTGTGG + Intronic
983190266 4:164747280-164747302 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
983479545 4:168256109-168256131 GGGGTAATGTCTGGGTGGCGGGG - Intronic
984004685 4:174294573-174294595 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
990151887 5:52827689-52827711 TGGTTGCTGACTGGGCAGGGTGG - Intronic
991373437 5:65940781-65940803 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
991723394 5:69515054-69515076 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
992964060 5:81983312-81983334 GGGCAGCTGACTGGGCAGAGGGG + Intronic
993162643 5:84312089-84312111 GGGGTGGTGGCTGGGCAGCGGGG + Intronic
994134794 5:96273854-96273876 GAAGTACTGACAGGGCACCGAGG + Intergenic
995895015 5:117002294-117002316 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
995942161 5:117599507-117599529 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
998402616 5:141855845-141855867 GGTGTAGTTGCTGGGCAGCGGGG + Intronic
998672790 5:144372640-144372662 GAGGTACTGACTGGACAAGGTGG + Intronic
1000159510 5:158583446-158583468 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1001608916 5:172984075-172984097 GGGGGCCTGACTCTGCAGCGCGG - Intronic
1003319240 6:5037539-5037561 GGGGTCCTGGCCGGGCAGAGGGG + Intergenic
1004537786 6:16519637-16519659 AGGGTACTTCCTGGGCATCGTGG - Intronic
1004664058 6:17735199-17735221 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1006833216 6:36981487-36981509 GGGGAACTCACTGCGCAGCATGG - Intronic
1007339743 6:41183239-41183261 GGGGTCCTGGCTGGGCAGAAGGG + Intergenic
1007724641 6:43907862-43907884 GAGGGCCTGACTGGGCAGTGGGG + Intergenic
1007902467 6:45423612-45423634 GGGGTGCTGACTGAGGCGCGCGG + Intronic
1009721524 6:67476788-67476810 GGGGTACTTACTTGGCAGTTTGG + Intergenic
1010264332 6:73850958-73850980 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1010513357 6:76744962-76744984 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1011262733 6:85485748-85485770 GGGGTTCTAATTGGGCAGAGCGG + Intronic
1011629049 6:89307203-89307225 GGGGTACAGCCTGGGCATCAGGG - Intronic
1012939579 6:105402871-105402893 GGGGTACTGAAGGGACAGCATGG + Exonic
1013681222 6:112528191-112528213 GGGGTGGTGGCTGGGCAGGGGGG + Intergenic
1014492807 6:122082747-122082769 GGGGTAGTGACAGGCCAGGGTGG + Intergenic
1017660780 6:156670630-156670652 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1019439776 7:1039637-1039659 GGGGTAGTGGCCGGGCAGAGGGG - Intronic
1019672358 7:2288053-2288075 CAGGTACTGGCTGGGCAGAGTGG + Intronic
1019981447 7:4624365-4624387 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1022446351 7:30473785-30473807 GGGGTACTCACTGAGCAGCTGGG + Intronic
1022663400 7:32387404-32387426 GGGGTCCTGGCCGGGCAGAGGGG + Intergenic
1023813069 7:43926978-43927000 GGAGGACTGACAGGGTAGCGGGG + Intronic
1024309942 7:47959834-47959856 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1024539019 7:50460514-50460536 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1025572913 7:62599634-62599656 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1025808589 7:64857113-64857135 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1026590889 7:71694681-71694703 GGGATAATGGCTGGGCACCGTGG - Intronic
1029334336 7:99887839-99887861 GGGGTGGTGGCTGGGCAGAGGGG + Intronic
1030063784 7:105643532-105643554 GGGGGACTAGCTGAGCAGCGGGG - Intronic
1030084699 7:105806329-105806351 CGGGTGCTCACTGGGCAGAGAGG - Intronic
1031850039 7:126852182-126852204 GGGGCACTCTCTGGGCAGGGAGG - Intronic
1032042693 7:128576540-128576562 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1032458542 7:132092578-132092600 GGGGTAGGGACTGTGCAGCCAGG - Intergenic
1034497839 7:151432844-151432866 GGGGTACTGTCTGTGCAAGGTGG - Intronic
1035924307 8:3710874-3710896 GGGCTACTGGCTGGGGAGCATGG + Intronic
1038151049 8:24942460-24942482 AGAGGACTGAGTGGGCAGCGCGG - Intergenic
1040819031 8:51535182-51535204 GGGGTCCTGGCCGGGCAGAGAGG - Intronic
1041070994 8:54125905-54125927 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1041358137 8:57022240-57022262 GGGCTCCTGGCTGGGCAGAGGGG - Intergenic
1041796442 8:61752757-61752779 GGGGTGCTGGCCGGGCAGAGGGG + Intergenic
1042367470 8:67953077-67953099 GGGGTACAGAGAGAGCAGCGGGG + Intronic
1043780296 8:84325686-84325708 CAGATACTAACTGGGCAGCGTGG - Intronic
1045136241 8:99221859-99221881 GAGGTACTGGCTGGGCATGGCGG - Intronic
1047011855 8:120681372-120681394 GGGTTACTGACTCTGCAGAGTGG + Intronic
1049570831 8:143369573-143369595 GGGGTGCTGACTGGGCAAGTGGG + Intronic
1049575191 8:143386589-143386611 GGGGTGCCGAGTGGGCAGCCGGG + Intergenic
1049698259 8:143994177-143994199 AGGGGACTGACTGGGCAGTGGGG - Intronic
1049765855 8:144354895-144354917 AGGCGACTGACAGGGCAGCGAGG + Exonic
1053457631 9:38243054-38243076 GGGGTAGTGGCCGGGCAGGGGGG - Intergenic
1053636517 9:40011061-40011083 TGGGTCCTGAGTTGGCAGCGGGG - Intergenic
1053769476 9:41453587-41453609 TGGGTCCTGAGTTGGCAGCGGGG + Intergenic
1054548143 9:66365066-66365088 TGGGTCCTGAGTTGGCAGCGGGG + Intergenic
1056763268 9:89429181-89429203 GGAGGGCTGACTGGGCAGGGAGG - Intronic
1057947038 9:99338691-99338713 GGGGCACTGGATGGGCAGTGAGG + Intergenic
1060041585 9:120305253-120305275 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1060350312 9:122852846-122852868 GGGGTGGTGGCTGGGCAGAGGGG - Intronic
1060810902 9:126611122-126611144 GGGGGAATGAATGGACAGCGGGG + Intergenic
1060873066 9:127058216-127058238 GAGGCAGTGACTGGGCAGCGGGG + Intronic
1060992553 9:127857210-127857232 TGGGGACAGACTGTGCAGCGTGG - Intergenic
1061104173 9:128516243-128516265 AAGGTCCTGACTGGGCATCGTGG - Intronic
1061224433 9:129272582-129272604 GGGAGACTGACTGGGAAGCATGG - Intergenic
1061909620 9:133715802-133715824 GGAGCACTGACTCGGCAGGGTGG - Intronic
1061982584 9:134115312-134115334 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1202790918 9_KI270719v1_random:89884-89906 GGGGTGCCGGCTGGGCTGCGCGG + Intergenic
1203771353 EBV:51478-51500 GGGGCACGGACTGGTCAGCGGGG - Intergenic
1187483954 X:19684388-19684410 GTGGTACTGACTGGGTGGGGAGG - Intronic
1191062907 X:56318403-56318425 GGGGTGCTGACTTGGCAGTGGGG - Intergenic
1191856946 X:65634885-65634907 GGGGTACTGACAGGGCTCCCAGG - Intronic
1192379617 X:70602066-70602088 GGGGTCCTGGCCGGGCAGAGGGG + Intronic
1195007872 X:100704472-100704494 GGGAGACTGACTGAGCAGAGAGG + Intronic
1197736297 X:129851435-129851457 GGGGTGGTGGCTGGGCAGAGGGG - Intergenic
1198476134 X:136999881-136999903 GGGGTGGTGGCTGGGCAGAGGGG + Intergenic
1200982349 Y:9273724-9273746 GGGGTACCTGCTGGGCAGTGTGG - Intergenic