ID: 917798349

View in Genome Browser
Species Human (GRCh38)
Location 1:178548264-178548286
Sequence GTTCCTCTGCAGGATGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917798342_917798349 16 Left 917798342 1:178548225-178548247 CCACAAATTCTTCATTTGAACTG 0: 1
1: 0
2: 1
3: 31
4: 377
Right 917798349 1:178548264-178548286 GTTCCTCTGCAGGATGTAAAAGG 0: 1
1: 0
2: 2
3: 19
4: 140
917798341_917798349 25 Left 917798341 1:178548216-178548238 CCAGAGAGGCCACAAATTCTTCA 0: 1
1: 0
2: 1
3: 9
4: 166
Right 917798349 1:178548264-178548286 GTTCCTCTGCAGGATGTAAAAGG 0: 1
1: 0
2: 2
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917798349 Original CRISPR GTTCCTCTGCAGGATGTAAA AGG Intronic
904255091 1:29249661-29249683 GTCCCCTTCCAGGATGTAAACGG - Intronic
913502872 1:119488113-119488135 GTTCATCTGCAGGGTAAAAAGGG + Intergenic
915454385 1:156029882-156029904 GCTCCTCTGAAGGATGTGAGAGG - Intergenic
916776042 1:167965497-167965519 CTCCCTCTGCTGGATGTACAAGG + Intronic
917798349 1:178548264-178548286 GTTCCTCTGCAGGATGTAAAAGG + Intronic
917918242 1:179726259-179726281 GTTCCTCTGCAAAATATACAGGG + Intergenic
920298932 1:204976659-204976681 GTACCTTTGCAGGATGAAGAAGG + Exonic
920357724 1:205387183-205387205 GTTCTCCTGCAGTATGTAGAAGG + Intronic
922500386 1:226093230-226093252 GTCCTGGTGCAGGATGTAAAAGG - Intergenic
923681150 1:236119735-236119757 GTTCTACTGCAGACTGTAAAGGG - Intergenic
1063350227 10:5347440-5347462 GGTCCTCTTCAGAGTGTAAAGGG - Intergenic
1063974207 10:11402222-11402244 GTTGCTTTACAGGATGTTAAAGG + Intergenic
1064890200 10:20162410-20162432 TTTCCTCTGCAAGTTGAAAAAGG - Intronic
1065637862 10:27749028-27749050 GTTCCTCTGCAGAATGTGATTGG - Intergenic
1066279265 10:33899200-33899222 GTGCCTTTGCAGGATGTGAATGG - Intergenic
1067531138 10:47074466-47074488 TGTCCTCTGCAAGATGTACAAGG + Intergenic
1068336081 10:55633709-55633731 GTTCCTTTGCCAGATGTAAGTGG - Intergenic
1068337739 10:55659447-55659469 GTTCCTCTGCAGGCTCTAAAAGG + Intergenic
1070975126 10:80600332-80600354 GTTTCTCTGCAGGATGTAACCGG + Intronic
1071278109 10:84075227-84075249 GTGCCTCACCAGGATGTAACAGG + Intergenic
1071695499 10:87864384-87864406 CTTCTTCTGCAGGATGGAAATGG - Exonic
1073054929 10:100693480-100693502 ATTCCTCAGAAGTATGTAAAGGG + Intergenic
1073887710 10:108059675-108059697 CTTCCTCTACAAGATGTAAATGG - Intergenic
1075773784 10:124965155-124965177 GTTCCTCAGAAGGATGTGTAAGG + Intronic
1080564882 11:33498816-33498838 GCCCCTCTGCAGGAAGAAAATGG - Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1082654002 11:55830189-55830211 CTTCCTCTGGCGGATCTAAAAGG + Intergenic
1087059484 11:93963770-93963792 TTTCCTCTGCAAGAGGTTAATGG + Intergenic
1088928732 11:114327844-114327866 GTTGCTCTGAAGTATGGAAATGG - Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1093592221 12:20916768-20916790 TTTCTTCTGCAGGATCTTAATGG - Exonic
1093993857 12:25620456-25620478 GTTTCTCTGAAGGATGAGAAAGG + Intronic
1095398274 12:41786132-41786154 GATACTCTGCAGAATGTGAAAGG - Intergenic
1096836145 12:54352494-54352516 CTTCCTCTGCAGGATTTTTAAGG + Intergenic
1098171965 12:67756263-67756285 GTTTCTCTGTAGGATGATAATGG - Intergenic
1101543701 12:105689327-105689349 CTTCCACTGCAGGCTGTAATAGG - Intergenic
1101559094 12:105838841-105838863 GTTGCTTTGCAGGTTGTAAATGG + Intergenic
1103772276 12:123337264-123337286 CTTCCTCTACAGGATCTTAAAGG + Intronic
1103900621 12:124301964-124301986 GCTCCTCTGGAGGCTGTAAGGGG + Intronic
1104202849 12:126608810-126608832 GTTTCCCTGTAGGGTGTAAATGG - Intergenic
1104959004 12:132479363-132479385 GTTCCTCTGCAGGCTGTGGGAGG + Intergenic
1105741525 13:23329053-23329075 TTTCTTTTGCAGAATGTAAAAGG - Exonic
1106990464 13:35413484-35413506 GTTCCTCTGTAGCTTTTAAAGGG + Intronic
1109330438 13:60922600-60922622 GTGCCTCTGAAGGATTAAAAAGG - Intergenic
1109848408 13:68028388-68028410 GTGCATATGCAGGAGGTAAAAGG - Intergenic
1110412152 13:75216081-75216103 ATTCCTCTCCAGGATGTTCAGGG + Intergenic
1113097838 13:106684781-106684803 GTTCTTATACAGGATGCAAAAGG + Intergenic
1113280824 13:108785647-108785669 GTCCTTCTCCAGGATGTGAATGG + Exonic
1116447023 14:45022252-45022274 CTTCCTCTGCAGGACAGAAAAGG - Intronic
1118737528 14:68712741-68712763 GTTCCTCTGAAGGAGAGAAAGGG - Intronic
1119001187 14:70883494-70883516 GCTCCAATGCAGGATGTCAAAGG - Intergenic
1119438733 14:74613880-74613902 GTTCCTCTCCAGGATGTTAGAGG + Intergenic
1119463864 14:74836890-74836912 TTTTCTTTGCAGGATGAAAAAGG - Intronic
1119926332 14:78497831-78497853 CTTCCTCTGTAGGATGAGAATGG + Intronic
1121178810 14:91911772-91911794 GGCCCTCTGGAGGATGCAAAAGG + Intronic
1124218234 15:27826918-27826940 GTTCTCCTGTAGGATGTTAAGGG - Intronic
1128253601 15:66180839-66180861 GTTCCTTTGCTGTATTTAAATGG - Intronic
1131133200 15:89912974-89912996 GTTCCTCGGCGGGATTTAAAGGG + Intergenic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1131220759 15:90582130-90582152 CTTCCTCTGGAGGAGATAAATGG + Intronic
1132178707 15:99735037-99735059 GTTTATCAGCAGGATGAAAACGG + Intergenic
1136519281 16:30785985-30786007 GATTCTCTGCAGGGTGTAAATGG - Intronic
1139366688 16:66437953-66437975 GTTCCTCTGAGGGATGTTAATGG + Intronic
1142279135 16:89138547-89138569 GTCCCTCTGCCGGATGAAAGGGG - Intronic
1148129167 17:45252803-45252825 GTACCACTGCAGGATGTCCATGG + Intergenic
1148533436 17:48417267-48417289 TTTCCTCTACAGGAGGTAGAAGG - Intronic
1156244091 18:35281273-35281295 GTTCCTCTCAATGAAGTAAATGG - Intronic
1156590641 18:38483999-38484021 TTTCTTCTACAGGAAGTAAAAGG + Intergenic
1159372440 18:67545817-67545839 GATTCTCTGCAGGATATATATGG - Intergenic
1160362925 18:78299084-78299106 GTTCCACTGAAGAATGAAAATGG + Intergenic
1161185476 19:2916110-2916132 GTTTCTCTGCAGGATATGTACGG + Exonic
1163729113 19:18939789-18939811 GTCCCTCTGCAGGGTGTAGTGGG - Intronic
1166560395 19:43729041-43729063 AGTCCTCTGCTGGATGTAAAGGG + Exonic
1167602143 19:50460469-50460491 CTTCCTCTGGGGGATGAAAATGG - Intronic
929311477 2:40431146-40431168 GTTTTTCTGCAGGCTGGAAAGGG + Intronic
929868656 2:45739456-45739478 AGTCCTCTGCAGGCTGTAAAAGG - Intronic
929939936 2:46325903-46325925 TTCCCTCTTCAGGATTTAAATGG - Intronic
934901828 2:98165842-98165864 GTTCATCTGCAGGATGACAGGGG - Intronic
936115781 2:109701959-109701981 GTACCTCAGCAGAATTTAAAGGG - Intergenic
936242371 2:110799031-110799053 GTTCCTGTCCGGGATGAAAACGG + Exonic
938367121 2:130743555-130743577 GTACCTCTGCAGCCTGGAAATGG + Intergenic
938781173 2:134586331-134586353 TTTCCTCTGCAGCCTGTAGAAGG - Intronic
938976493 2:136483226-136483248 GTGCCTATGCAGCATGTAAAGGG + Intergenic
939306775 2:140421902-140421924 CTTCGTCTGCAGGATGGAAAGGG - Intronic
943739062 2:191391188-191391210 GCTCCTCTGCAGGCTGAAGAAGG + Intronic
943953793 2:194161225-194161247 GAGCCTCTGCAGAATGCAAAGGG + Intergenic
946428796 2:219613789-219613811 GTTCCCCTGCAGGATCTGAGTGG + Exonic
946968801 2:225068777-225068799 CTTCATCTGCAGCATGAAAACGG + Intergenic
1173317980 20:41962052-41962074 GTTCATCTGAAGGTTGGAAATGG - Intergenic
1173558812 20:43987291-43987313 GTTCATGTGCTGTATGTAAATGG - Intronic
1173940631 20:46908073-46908095 TTTCCTCTTCAGTATGGAAATGG + Intronic
1178280733 21:31280503-31280525 GTTTATCAGCAGGATGAAAATGG + Intronic
1181377718 22:22473554-22473576 GTTCATCTACAGGGTGAAAAGGG - Intergenic
1183470086 22:38000570-38000592 GTTCCTCTGCAGTCTGTGCAGGG + Intronic
1184370728 22:44080386-44080408 GTGCCTCTGCAAGTTGGAAAAGG - Intronic
955530260 3:59865580-59865602 GAGCCTCTGCAGGACATAAAAGG + Intronic
960171756 3:114470471-114470493 GTTTCTCTTCAAGATGAAAAAGG - Intronic
960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG + Intronic
961610463 3:128133146-128133168 GTTCTTCTGCATGAGGAAAAGGG + Intronic
961677299 3:128575616-128575638 CTTCCCCAGCAGGATGTATATGG + Intronic
963368113 3:144364338-144364360 GTCACTCTGCAGGATGTTTAGGG + Intergenic
964080253 3:152745761-152745783 ATTCCTGAGCAGGTTGTAAATGG + Intergenic
967513505 3:190340277-190340299 TTTCATCAGCAGGATGAAAATGG - Intronic
967871485 3:194233507-194233529 CTACCTCTGCAGGATCTCAAAGG - Intergenic
969878124 4:10150964-10150986 GTTACTCTGCATGAAGAAAAAGG + Intergenic
972614896 4:40688536-40688558 TTCCTTCTGCAGGATGTGAATGG - Intergenic
976802883 4:89012644-89012666 GTTCATCTACAAGATGTTAAGGG + Intronic
977017824 4:91715694-91715716 GTTACTCTGCAGGGTGAATAAGG - Intergenic
977532636 4:98218011-98218033 GGTCATCTGCAGCATATAAATGG + Intergenic
978094644 4:104761259-104761281 TTCCCTTTGCAGGATGTACAAGG + Intergenic
984985847 4:185328957-185328979 GTTCATCTGCAGGCTCAAAAGGG + Intronic
986284700 5:6350766-6350788 GCTCCTCTGCAGGACCTGAATGG + Intergenic
987485899 5:18526026-18526048 CTTCCACTGCAGGATGTATGTGG - Intergenic
989381553 5:40813924-40813946 GTTCCTGTGGAGGATGTAATTGG + Intergenic
989968360 5:50491301-50491323 GTTCATCAGCAGCATGAAAATGG - Intergenic
993662491 5:90654954-90654976 GTTCCTCTGCAGTAAGTCAGAGG - Intronic
994816242 5:104591656-104591678 GTTCATCTGCAGAATCGAAAGGG - Intergenic
995033923 5:107512281-107512303 GCTCCTCAGTAGGGTGTAAATGG + Intronic
1002714473 5:181217846-181217868 GTTCCTCTGCAGGAAGCCCAGGG + Intergenic
1003583451 6:7363694-7363716 CTTCCTCTGCACCATGTCAAGGG + Intronic
1003734526 6:8863685-8863707 GGTCCTCTGCAGGTTGTCCAAGG - Intergenic
1004294328 6:14396497-14396519 CTTCCTCTGCAGGCTGTAATAGG + Intergenic
1009194497 6:60667805-60667827 CTTCATCTGCAGCATGAAAATGG - Intergenic
1010332786 6:74644429-74644451 GTTCCTCTGAACCATGTAACTGG - Intergenic
1012627821 6:101425865-101425887 TTTCCTCTCCAGGATTTGAAGGG + Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014691310 6:124566588-124566610 TTTTCTCTGCAGGATATTAATGG + Intronic
1014750811 6:125253835-125253857 GTTCCTCTGCTTTATGTGAAAGG + Intronic
1014856378 6:126406956-126406978 GTACATGTGCAGGATGTACAGGG + Intergenic
1014955110 6:127605810-127605832 CTTCCTATGATGGATGTAAATGG + Intergenic
1017580635 6:155860717-155860739 GTTTCTCTCAAGGATGAAAAGGG - Intergenic
1017772206 6:157652072-157652094 CCTCCTCTGCAGGATGTCAAAGG - Intronic
1019801419 7:3091030-3091052 GAACCCCTGAAGGATGTAAAGGG + Intergenic
1021405694 7:20264728-20264750 GTGCCTCAGCAGGATTTGAATGG + Intergenic
1023105042 7:36755743-36755765 GGCCCTCTGCCAGATGTAAAAGG - Intergenic
1023619067 7:42051144-42051166 GCTTCTCAGCAGTATGTAAAAGG - Intronic
1026271273 7:68839190-68839212 ATTCCTCTGCATGATGTAGATGG - Intergenic
1026405710 7:70063315-70063337 GTTGCTCTGCTAGATTTAAATGG + Intronic
1026955192 7:74372494-74372516 GTTCCCCTGCAGGCTGTCACTGG - Intronic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1033347948 7:140540094-140540116 GTACCTCTGAAAGCTGTAAAGGG + Intronic
1037305359 8:17497750-17497772 GGTCCCCTGCAGAATGTGAAGGG - Intronic
1037689520 8:21170546-21170568 TCCCCTCTGCAGGATGTGAACGG + Intergenic
1039944158 8:42115839-42115861 GTACCTCGGCAGGATTCAAATGG + Intergenic
1041188859 8:55332304-55332326 ATTTTTCTGCAGGATTTAAAAGG - Intronic
1043909767 8:85849504-85849526 GGGCCTATGCAGGTTGTAAAAGG - Intergenic
1045421035 8:102015337-102015359 GTTCCTTTGCAGGAAATACATGG - Intronic
1046916840 8:119687156-119687178 GTTGCTCTGCAGTATGGAACAGG + Intergenic
1048566419 8:135602891-135602913 GTTCCTCTGTATGGTGCAAATGG - Intronic
1051711172 9:19932914-19932936 GTTCCTTTGAAGGACTTAAAAGG - Intergenic
1052888768 9:33676711-33676733 GGGGCTCTGCAGGATGGAAATGG + Intergenic
1056003765 9:82244977-82244999 GTTCCTGTGAAGAATGTAATTGG + Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1057917177 9:99065744-99065766 TGTCCTCTGCAGGAAGGAAAGGG + Intronic
1058986209 9:110210436-110210458 GTTCCTCTGAAGGATATACCTGG - Intergenic
1060947746 9:127580001-127580023 GGTCCTCTCCACGATGTAACTGG - Intergenic
1061662209 9:132137716-132137738 GTTCCTTTCCAGGCTGTAAGGGG - Intergenic
1189906752 X:45768967-45768989 GTTCCTGTTCATGATGTATAAGG - Intergenic
1192573028 X:72221944-72221966 GTTCATCTGCAGGGTCAAAAGGG - Intronic
1193222687 X:78945444-78945466 GTTTCTTTGCAGGGAGTAAAGGG - Exonic
1196786575 X:119426212-119426234 GTTCCTCTTGAGGCTGTAATGGG + Intronic
1201636176 Y:16125619-16125641 GTTCCCCTATAGGATCTAAAAGG - Intergenic