ID: 917805235

View in Genome Browser
Species Human (GRCh38)
Location 1:178607179-178607201
Sequence CTGTAGAAGGTGATGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917805235_917805240 12 Left 917805235 1:178607179-178607201 CCAACCAACATCACCTTCTACAG No data
Right 917805240 1:178607214-178607236 GACTACTTTCCCTCACCTCCAGG No data
917805235_917805245 30 Left 917805235 1:178607179-178607201 CCAACCAACATCACCTTCTACAG No data
Right 917805245 1:178607232-178607254 CCAGGTGCCCCGTGAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917805235 Original CRISPR CTGTAGAAGGTGATGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr