ID: 917809335

View in Genome Browser
Species Human (GRCh38)
Location 1:178642319-178642341
Sequence GAAATTAGCATGTCTAAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917809332_917809335 7 Left 917809332 1:178642289-178642311 CCTAATGGAAGAGCCTAGGTGTA No data
Right 917809335 1:178642319-178642341 GAAATTAGCATGTCTAAACCCGG No data
917809334_917809335 -6 Left 917809334 1:178642302-178642324 CCTAGGTGTAGCATGAGGAAATT No data
Right 917809335 1:178642319-178642341 GAAATTAGCATGTCTAAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917809335 Original CRISPR GAAATTAGCATGTCTAAACC CGG Intergenic
No off target data available for this crispr