ID: 917810877

View in Genome Browser
Species Human (GRCh38)
Location 1:178657372-178657394
Sequence CTGTTGACTCAGTTTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917810867_917810877 23 Left 917810867 1:178657326-178657348 CCTCAGTCCATAATTTAATAAAC No data
Right 917810877 1:178657372-178657394 CTGTTGACTCAGTTTGGGCTGGG No data
917810868_917810877 16 Left 917810868 1:178657333-178657355 CCATAATTTAATAAACACTGCAG No data
Right 917810877 1:178657372-178657394 CTGTTGACTCAGTTTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917810877 Original CRISPR CTGTTGACTCAGTTTGGGCT GGG Intergenic
No off target data available for this crispr