ID: 917817333

View in Genome Browser
Species Human (GRCh38)
Location 1:178724884-178724906
Sequence ACCGCCTGGCCACCCGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917817333_917817346 30 Left 917817333 1:178724884-178724906 CCGGGAGCGGGTGGCCAGGCGGT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 917817346 1:178724937-178724959 CCCTTCCCCCCCCCGTTGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917817333 Original CRISPR ACCGCCTGGCCACCCGCTCC CGG (reversed) Intergenic
900169941 1:1262234-1262256 ACGCCCTGGACACCTGCTCCCGG + Intronic
900269109 1:1778203-1778225 CCCGCCTGGCCGCGCGCTCGCGG + Intronic
900554184 1:3271579-3271601 CCTGCCTGGCCTCACGCTCCAGG - Intronic
900790146 1:4674611-4674633 AAGGCCTGGCCAGCCACTCCTGG - Intronic
900798445 1:4723487-4723509 GCCTCCTGGCCACCTCCTCCCGG - Intronic
900993024 1:6106634-6106656 GCCGCCTGACCAACCGCGCCGGG - Exonic
901660299 1:10794881-10794903 ACCGCCCGCCCGCCCGCGCCCGG + Intronic
903295908 1:22342959-22342981 ACCTCCTGGACTCCCACTCCAGG + Intergenic
905887982 1:41501958-41501980 CCCGCCTGCCCGCCCGCCCCAGG + Intergenic
907048918 1:51316677-51316699 ACCACCTGGCCCCTCGCTCTTGG + Intronic
910183120 1:84506515-84506537 ACCTCCTGGTCACCCGCCGCCGG - Exonic
912246128 1:107964087-107964109 GCCGGCTGGCCACCAGCTCAGGG + Intronic
913078548 1:115360832-115360854 TCTGCCTGGCCACCCCCTCTGGG - Intergenic
915213392 1:154325733-154325755 CCCTCCTGGCCCCGCGCTCCCGG - Intronic
917817333 1:178724884-178724906 ACCGCCTGGCCACCCGCTCCCGG - Intergenic
919936983 1:202259835-202259857 GCAGCCTGGACACCCTCTCCAGG + Intronic
920091015 1:203453299-203453321 TCCTCCTGGCCACCAGCCCCAGG + Intergenic
1062862995 10:824649-824671 TCTGCCTGGTTACCCGCTCCAGG + Intronic
1063068093 10:2629908-2629930 ACCTCGTGGCCGCCCGCCCCGGG + Intergenic
1063118622 10:3088497-3088519 ACCCCCAGGCAACGCGCTCCAGG - Intronic
1067091393 10:43267221-43267243 AAAGCCTGGCCGCCCTCTCCCGG - Intergenic
1067119930 10:43465067-43465089 CCCGCCCGGCCAGCCGCCCCGGG - Intronic
1067437340 10:46287384-46287406 ACCGCCTGGCCCTGGGCTCCAGG + Exonic
1067751332 10:48973706-48973728 ACCCCCTGGCCAACTGCTGCAGG - Intronic
1071298145 10:84237437-84237459 ACCGCCTGGCCGCCTTCCCCTGG - Exonic
1072659828 10:97357015-97357037 GCTGCCTTGCCACCAGCTCCAGG - Exonic
1075922557 10:126225193-126225215 AGCTCCTGGCCACCCTTTCCAGG - Intronic
1076816992 10:132919925-132919947 CTCGCCAGGCCACCTGCTCCAGG - Intronic
1077337180 11:2010666-2010688 CCTGCCTGGGCCCCCGCTCCTGG + Intergenic
1077364448 11:2155918-2155940 GCCGCCTGGACCCCAGCTCCAGG + Intronic
1077410759 11:2402930-2402952 CCCGTCTGGCCGCCCCCTCCAGG - Exonic
1078104497 11:8350270-8350292 ACTGCCTGGCCTCCTGCTCTGGG - Intergenic
1079689462 11:23403705-23403727 GCCAACTGGCCACCTGCTCCAGG - Intergenic
1084265694 11:68004091-68004113 ACCGCCCGGCCACTTCCTCCCGG + Exonic
1084482856 11:69432158-69432180 ACCTCCTGGCCCCCTGCTTCTGG + Intergenic
1084789394 11:71463792-71463814 AGCGCCTGGTCACCAGCTGCTGG + Intronic
1085010956 11:73141710-73141732 ACCGACTTGCCGCCGGCTCCAGG - Intronic
1090616880 11:128522614-128522636 CCAGCCTGCACACCCGCTCCCGG - Intronic
1202820164 11_KI270721v1_random:65848-65870 CCTGCCTGGGCCCCCGCTCCTGG + Intergenic
1091688187 12:2578534-2578556 ACTGCCTGGACCCCCGCTCCGGG - Intronic
1097089373 12:56493873-56493895 TCTGCCTGGCCACCCGCTCTGGG - Intergenic
1097126835 12:56783241-56783263 CCCGCCCGGCCACCCCGTCCGGG - Intronic
1100048253 12:90411291-90411313 CCCGCCCGGCCAGCCGCCCCGGG + Intergenic
1102310649 12:111842216-111842238 ATCGCCGGGACACCCGCGCCGGG - Intronic
1102566215 12:113799038-113799060 ACCTTCTGCCCACCCACTCCTGG + Intergenic
1103443597 12:120980271-120980293 ACTCCCTGGCCACCCCCTGCAGG - Intronic
1104948300 12:132427296-132427318 ACCCCCCGGCCACCCGCCCCAGG - Intergenic
1104948357 12:132427419-132427441 ACCCCCCGGCCACCAGCCCCAGG - Intergenic
1107455002 13:40546635-40546657 ACAGCCTGGCCTCCTGCTCCAGG - Intergenic
1113492492 13:110703385-110703407 TCAGCCTGGCCAACCCCTCCAGG - Intronic
1113781832 13:112981647-112981669 ACCGGATGACCACCAGCTCCTGG + Intronic
1113839604 13:113351225-113351247 ATGGCCTGGCCACCAGCTCTGGG - Intronic
1113874295 13:113584885-113584907 ATCCCCTGCCCACCCGCACCTGG - Exonic
1113933816 13:113982604-113982626 AGCGCCTGGGCACGCACTCCCGG + Intronic
1114957762 14:27845539-27845561 ACCGCCAGCCCGCCCGCTGCGGG + Intergenic
1117339183 14:54779190-54779212 AACGCCTGGCCACAAGCCCCGGG - Intronic
1118608692 14:67522756-67522778 ACTGCCTCACCACCCGCTCCAGG - Intronic
1120771619 14:88385864-88385886 GCCGCCTCGCCCCTCGCTCCAGG + Intronic
1121338669 14:93092362-93092384 AGCGCCTGGCTTCCTGCTCCAGG - Intronic
1122419035 14:101563960-101563982 GCCTCTTGCCCACCCGCTCCAGG + Intergenic
1122889575 14:104726086-104726108 CCCGCCAGGCCACCCCCACCAGG + Intronic
1124215525 15:27805075-27805097 TCAGCCTGACCACTCGCTCCAGG - Intronic
1125524665 15:40367473-40367495 ACCGGCTGGCCACCCCCTGGGGG + Exonic
1125725436 15:41866094-41866116 TCCGCCTGTCCTCCAGCTCCTGG + Exonic
1125760825 15:42094414-42094436 ACCACCTGGCCACCCTTACCAGG - Exonic
1128582196 15:68818270-68818292 GCGGCATGGCCACCAGCTCCCGG + Intronic
1128811433 15:70575702-70575724 ACAGCCGGGCCACCCACTACTGG - Intergenic
1129457604 15:75683982-75684004 ACCACCAGGCCACCCGCTACGGG + Intronic
1131164218 15:90130560-90130582 ACCTGCTGGTCCCCCGCTCCTGG - Intergenic
1132105429 15:99059374-99059396 CCCGCCTGGCTCCCCGCGCCTGG - Intergenic
1133802093 16:9092296-9092318 ACCGCTTGGCCGCCCCCGCCCGG + Intronic
1136652107 16:31681897-31681919 ATTGCCTGGCCACCAGCCCCTGG + Intergenic
1136671732 16:31864674-31864696 ATTGCCTGGCCACCAGCCCCTGG + Intergenic
1141613651 16:85198049-85198071 ACGTCCTGGCCACCCTCTGCTGG - Intergenic
1141941276 16:87277821-87277843 ACCGCCTGTCCTCCTCCTCCAGG + Intronic
1142709536 17:1715772-1715794 ACCTCCTCGCCGCCCGCTCGGGG + Intergenic
1143030532 17:3964633-3964655 ACCCCCGGGCCACGCGCCCCCGG - Intergenic
1144653340 17:17020368-17020390 ACCGCATGGCCACCAGCTTCAGG + Intergenic
1146453924 17:32995091-32995113 ACCGCCTGGCCATCCCCTCCGGG + Intronic
1147265037 17:39229525-39229547 GCAGCCTGGCCAGCCTCTCCTGG + Intergenic
1148680829 17:49472631-49472653 AAGGCGTGGCCACCCCCTCCTGG - Intronic
1148859964 17:50599658-50599680 AACTCTTGGCCTCCCGCTCCAGG - Exonic
1148919802 17:51020620-51020642 ACCTCCTGGCCCCCAACTCCTGG + Intronic
1150133193 17:62680247-62680269 ACTGCATGGCCACCCACTGCAGG - Exonic
1150823946 17:68457769-68457791 CCCGGCTGGCGACCCGCCCCTGG + Intergenic
1151507907 17:74541508-74541530 ACCTCCTGACCACTCCCTCCCGG - Exonic
1151509439 17:74549318-74549340 ACCTCCTGACCACTCCCTCCCGG - Intergenic
1151670640 17:75570066-75570088 AGCGCCTGGCAGCCCGCTCAGGG + Exonic
1152659796 17:81536971-81536993 GCCGCCTGGCCATCCGCGCCCGG + Exonic
1152758575 17:82097302-82097324 GCGGCCTGGGCACCCGTTCCGGG - Intronic
1153276290 18:3371216-3371238 ACAGCATGGCCACCAGCCCCAGG - Intergenic
1154003416 18:10506122-10506144 TCTGCCTGGCCACCCCCTCTGGG - Intergenic
1154003454 18:10506274-10506296 TCTGCCTGGCCACCCCCTCTGGG - Intergenic
1154003567 18:10506690-10506712 TCTGCCTGGCCACCCCCTCTGGG - Intergenic
1158686721 18:59621375-59621397 ACTGCCTGACCACCTGCTCTGGG + Intronic
1158696816 18:59710807-59710829 ACCTCCTGGCTTCCAGCTCCGGG + Intergenic
1160680213 19:408827-408849 AACGCCTGGCCCTCCGGTCCAGG - Intronic
1160995606 19:1880772-1880794 CCAGCCTGGCCACCTGCTCCTGG - Intronic
1162412866 19:10517168-10517190 ATCCCCTGGCCACCCCCTCCTGG - Intronic
1163154152 19:15431075-15431097 GCCGACTGGCCACCTGCTCCAGG + Intronic
1167661433 19:50798138-50798160 ACCGCCTGGCCTGGTGCTCCAGG - Exonic
1168062203 19:53899136-53899158 ACCGCCTGGCCACGCCCCCGAGG - Intronic
1168106275 19:54167695-54167717 ACCTCCTGGGCCACCGCTCCTGG + Intronic
1168359335 19:55725634-55725656 ACCGCCCTGTCACCAGCTCCTGG - Intronic
926159632 2:10478409-10478431 ACCCACTGGACACCAGCTCCTGG - Intergenic
926199127 2:10780722-10780744 ACCGATGGGCCAGCCGCTCCTGG + Intronic
926294993 2:11562627-11562649 CCCGCCTGGCCACTGCCTCCGGG - Intronic
927705063 2:25291627-25291649 CCAGCCTGGGCACCCCCTCCAGG + Intronic
928322935 2:30297708-30297730 ACTGCCTGGCCACCCACTGTAGG - Intronic
930089405 2:47520884-47520906 ACCGCCCGTCCGCCCGCGCCGGG - Exonic
934479537 2:94622394-94622416 ACTGCCGGCCCACCCGCTCTAGG - Intergenic
934676496 2:96253303-96253325 GCCCCCAGGCCACCTGCTCCGGG - Exonic
937140554 2:119596275-119596297 ACCCCCTAGCCACCCACTGCTGG - Intronic
937895473 2:126974139-126974161 ACCGCCTGGGAACCCCCACCAGG + Intergenic
938070609 2:128306373-128306395 ACAGCCTGGCTCCCTGCTCCAGG + Intronic
939990884 2:148875934-148875956 CCCGCCCGGCCCGCCGCTCCCGG - Intronic
941916233 2:170815810-170815832 ACCGTCTGGCCAGCAGCTCCAGG + Intronic
944533031 2:200683906-200683928 CCCGCCCGGCCAGCCGCCCCGGG - Intergenic
945033451 2:205685382-205685404 TCGCCCTGGCCACCCGCTGCCGG - Intronic
946229999 2:218285495-218285517 ACAGCCTGGCCAACGGCCCCAGG + Intronic
946238411 2:218339785-218339807 ACAGCCTGTACACCCGCACCTGG + Exonic
946249951 2:218405818-218405840 ACCCCCCGCCCACCCGCTCTGGG - Exonic
946404431 2:219484843-219484865 ATCGGCTGGACAGCCGCTCCAGG - Exonic
948121621 2:235535167-235535189 TCCACCGGGCCACCCGCACCAGG + Intronic
948257458 2:236578442-236578464 ACGGCCAGGCCTCCCGCTGCAGG + Intronic
948886975 2:240889396-240889418 CCCGGCTGGCCACACACTCCAGG + Intronic
1171282656 20:23914081-23914103 ACCGCCTTGCTACCAGCTCAGGG + Intergenic
1172162799 20:32880050-32880072 CCTGCCTGGCCACCTGCCCCAGG - Intronic
1172951090 20:38724020-38724042 ACCCCCGGACCACCCCCTCCAGG - Intergenic
1172997719 20:39083431-39083453 ACCGCCTGCCCTCTGGCTCCTGG - Intergenic
1174405294 20:50298942-50298964 CCCACCTGCCCACCCGCTGCCGG - Intergenic
1175090994 20:56504074-56504096 ACCGCCAGGACTCCCCCTCCAGG - Intronic
1175310788 20:58010470-58010492 ACCCCCTTGCCACTCGCTCCAGG - Intergenic
1175500701 20:59448498-59448520 AGAGCCTCGCCACCCCCTCCAGG - Intergenic
1175918026 20:62436519-62436541 AGGGCCTGGCCATCCGCGCCTGG - Intergenic
1176797115 21:13379179-13379201 TCTGCCTGGCCACCCCATCCAGG + Intergenic
1176797280 21:13379739-13379761 TCTGCCCGGCCACCCGCTCTGGG + Intergenic
1178922577 21:36748092-36748114 ACCCGCTGGCCGCCCGCGCCAGG + Exonic
1178939736 21:36895082-36895104 GCTGCCTGGCCACGAGCTCCAGG + Intronic
1179235090 21:39538795-39538817 ACCGCCTGGCCATCAACTCATGG + Intergenic
1179902074 21:44399576-44399598 ACCCCTCGGCCACCTGCTCCAGG + Intronic
1181007488 22:20020936-20020958 ACCTCCTGGCGCCCCGCCCCCGG - Intronic
1181023881 22:20116948-20116970 GCCGCCTGGCCACCTCGTCCTGG + Exonic
1182130092 22:27844443-27844465 ACCTCCTGGCCAGCACCTCCTGG + Intergenic
1182283970 22:29233236-29233258 ACCACCTGGGCACCTGCTCCAGG - Intronic
1183370166 22:37427611-37427633 TCCGCCAGCCCGCCCGCTCCCGG + Intergenic
1184159352 22:42688691-42688713 ACCGACTGGACACCGGCCCCAGG - Intergenic
949188409 3:1221031-1221053 ACCCCCTACCCACCAGCTCCAGG + Intronic
950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG + Intronic
954745699 3:52786414-52786436 ACCGCTTGGCCAGCAGCTCCTGG - Exonic
954954603 3:54508189-54508211 ACCACCTGGCCAGCCCTTCCAGG - Intronic
958942950 3:100334946-100334968 GCCGCCCGGCCACGCGATCCCGG - Intronic
960950111 3:122993736-122993758 GCCCCCTTGCCACCCGCTCTGGG + Intronic
962772688 3:138627884-138627906 ACTGCCTGGCCATCTGCTCCAGG - Intronic
969641114 4:8399343-8399365 ACCCCCTGGACACCAGCACCTGG + Intronic
984952818 4:185019505-185019527 AACGCCTGGCACCCGGCTCCGGG - Intronic
985129655 4:186726757-186726779 CCCGCCTCGCCCCCCGCCCCGGG + Intergenic
985682177 5:1261809-1261831 GCAGCCTGGCCTCCTGCTCCGGG - Intronic
986968575 5:13305035-13305057 ACCGACTGGCTACACCCTCCTGG + Intergenic
990501036 5:56397770-56397792 CCTGCCTGGCCACCCGGTCTGGG - Intergenic
990709438 5:58564476-58564498 TCTGCCTGGCCGCCCGCTCTGGG - Intergenic
997676314 5:135715549-135715571 ACAGCCTCCCAACCCGCTCCTGG - Intergenic
1002323432 5:178389277-178389299 GCCTCCTGGCCACCTCCTCCAGG + Intronic
1002389203 5:178896134-178896156 AGCGCCGGGCCTCCGGCTCCAGG + Intronic
1005825799 6:29631424-29631446 AGTGCCTGGCCAACGGCTCCTGG - Exonic
1005860500 6:29896502-29896524 ACCTCCTGGCCACAGGCACCTGG - Intergenic
1006978333 6:38124416-38124438 CCCGCCTGGCCCCCCGCTGTGGG - Intronic
1007260550 6:40559995-40560017 ACCCCCAGGCCTCCAGCTCCTGG + Intronic
1010451775 6:76012242-76012264 ACAGCCTGGCCATTCTCTCCAGG + Intronic
1018853738 6:167661074-167661096 CCAGCCTGGCCACCCACCCCAGG + Intergenic
1019734679 7:2644866-2644888 ACTGCCTGGCAACCGTCTCCTGG + Intronic
1022380436 7:29854200-29854222 ACAGCCTAGCCACCTGCTGCTGG + Intronic
1024231491 7:47367183-47367205 ACAGCCTGGCCGTCCTCTCCTGG + Intronic
1026828311 7:73597131-73597153 ACCCCCTGGCCTCCCTCCCCAGG + Intronic
1029672826 7:102045861-102045883 TCCGCCAGGGGACCCGCTCCAGG + Intronic
1030738787 7:113084003-113084025 GCTGCCTGGCCACTGGCTCCAGG + Exonic
1033529182 7:142245774-142245796 ACCTCCTGCCCACCTGCCCCAGG - Intergenic
1036694817 8:10967585-10967607 AGAGCCTGGCCTCCAGCTCCAGG - Intronic
1037037056 8:14180768-14180790 ACAGTCTGGCCACCTGCTTCAGG - Intronic
1037833330 8:22201642-22201664 GTCGCCTGGCCTCCCACTCCCGG + Intronic
1040592196 8:48803821-48803843 AAAGCCTGGTCCCCCGCTCCAGG - Intergenic
1043573507 8:81630964-81630986 CCCCCCTCGCCACCCTCTCCGGG - Intergenic
1044582275 8:93834658-93834680 TCTGCCTGGCCACCCCCTCTGGG - Intergenic
1044637443 8:94340998-94341020 CCCGCCTGGCCGCCCCCGCCTGG + Intergenic
1049337548 8:142094472-142094494 ACCTCCGGGGCTCCCGCTCCAGG - Intergenic
1049709561 8:144057501-144057523 ACCCCATGGCCACCTCCTCCAGG + Exonic
1049746904 8:144266795-144266817 GCCCCCTGGCCCCCCGCCCCCGG - Exonic
1053388133 9:37711518-37711540 ACTGACTGGCCACCCACTGCCGG - Intronic
1057079226 9:92159849-92159871 TCTGCCTGGAGACCCGCTCCTGG - Intergenic
1057173167 9:92976074-92976096 ACCCCCAGCCCACCTGCTCCAGG + Intronic
1058684068 9:107465585-107465607 ACTGCCTGGCTTCCAGCTCCCGG - Intergenic
1059345412 9:113624939-113624961 ACGGCCTGGCCACCCCCTCTGGG + Intergenic
1060106522 9:120876579-120876601 CCCGCCCGGCCCCGCGCTCCCGG - Intronic
1060727257 9:126014851-126014873 AGCCCCTGGCCACTCCCTCCGGG - Intergenic
1062004907 9:134234171-134234193 ATCCCATGGCCACCCGCCCCTGG - Intergenic
1062041237 9:134405211-134405233 CCCGCCTGGCCTCCCCATCCTGG + Intronic
1062430595 9:136525374-136525396 ACCTCCTGGCCTTGCGCTCCGGG + Intronic
1062454805 9:136630396-136630418 GCCCCCTGCCCACCAGCTCCTGG + Intergenic
1189848542 X:45157825-45157847 AGCGCCTGACCACGCGATCCAGG + Exonic
1192795747 X:74422772-74422794 ACCGCCTCCCCGCCCGCTCTGGG - Intronic
1192885904 X:75335471-75335493 TCTGCCTGGCCACCCCCTCTGGG - Intergenic
1198438177 X:136636950-136636972 ACAGCCTGGCCCCCAGCCCCAGG - Intergenic
1199274266 X:145923454-145923476 ACAGTCTGGCCACCAGCTTCAGG - Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1201294801 Y:12453820-12453842 TCTGCCTGGCCACCCGGTCTTGG - Intergenic