ID: 917817473

View in Genome Browser
Species Human (GRCh38)
Location 1:178725429-178725451
Sequence CTCAGGCCGCGGGGCGGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917817461_917817473 15 Left 917817461 1:178725391-178725413 CCTCTGAGGCGACGGCCGCGGCT 0: 1
1: 0
2: 1
3: 12
4: 111
Right 917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG 0: 1
1: 0
2: 5
3: 19
4: 218
917817459_917817473 19 Left 917817459 1:178725387-178725409 CCGTCCTCTGAGGCGACGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 57
Right 917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG 0: 1
1: 0
2: 5
3: 19
4: 218
917817465_917817473 0 Left 917817465 1:178725406-178725428 CCGCGGCTGCACAGGTCGGTGGG 0: 1
1: 0
2: 3
3: 20
4: 207
Right 917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG 0: 1
1: 0
2: 5
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917817473 Original CRISPR CTCAGGCCGCGGGGCGGTGC GGG Intronic
900088426 1:909240-909262 GTCAGGCCCCCGGGCGTTGCTGG + Intergenic
900088544 1:909596-909618 GTCAGGCCCCCGGGCGTTGCTGG + Intergenic
900088603 1:909771-909793 GTCAGGCCCCCGGGCGTTGCTGG + Intergenic
900360773 1:2287871-2287893 CTCAGGGCTCGGGGTGGGGCCGG - Intronic
900956675 1:5890216-5890238 CTCAGGCCACGGGACGGAGCTGG - Intronic
901050717 1:6424700-6424722 CGGAGGCTGCGGGGCGGGGCGGG + Intergenic
901296072 1:8161795-8161817 CTCAGGCCCCGTGGTGGTGGGGG + Intergenic
901875869 1:12166935-12166957 GCCAGGCGGCGGGGCGGGGCGGG - Intergenic
902509947 1:16961074-16961096 CACTGGCCGCGGGGCTGGGCTGG - Exonic
903848296 1:26291238-26291260 CTGAGGCCCCTGGGCGGAGCAGG + Intronic
904034666 1:27552131-27552153 CGCAGGCCGCCGGGCGGGGCCGG + Exonic
904618038 1:31760532-31760554 CTCAGGCCCAGGGCCGGTCCGGG + Intronic
905626051 1:39491348-39491370 CTAAGGCCGCGGCGCCGTCCCGG - Intergenic
906805656 1:48776865-48776887 CTCAGCCCGCGGGGCGGGCGCGG + Exonic
908523517 1:64966567-64966589 GGCCGGCCGCGGGGCGGGGCGGG - Intergenic
912269241 1:108192633-108192655 CTCAGGCCGCGGAGCTGCGAGGG - Intronic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
912539959 1:110407415-110407437 CCAAGGCCGCAGGGCGGGGCGGG - Intronic
912554769 1:110508134-110508156 CTCAGGCTCCTGGGCGGGGCTGG + Intergenic
913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG + Intergenic
914196460 1:145450507-145450529 CTCAGGCCACGGGGAGGAGGTGG - Intergenic
915932906 1:160070772-160070794 CTAAGTCCCCGGTGCGGTGCTGG + Intergenic
917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG + Intronic
918066564 1:181105490-181105512 CTCAGCGGGCGGGGCGGGGCGGG + Intergenic
919486814 1:198156935-198156957 CTCACGACGCGGGGTGGGGCCGG + Intergenic
919820564 1:201469310-201469332 CGCAGGGCGCGGGGCGGGGAGGG + Intergenic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
922488882 1:225999458-225999480 GCCGGGCGGCGGGGCGGTGCGGG + Intergenic
924199034 1:241640441-241640463 GACAGGCCGCGGGGAGGGGCGGG - Intronic
1062843538 10:688913-688935 CTCAGGCCGTGCAGCGGTCCTGG - Intronic
1063443042 10:6089051-6089073 CTCAGGGCGCTCGGCGGCGCGGG - Intronic
1064712363 10:18140540-18140562 CTCAGTGCGCGGGACGGGGCCGG - Intergenic
1066351489 10:34641319-34641341 CTCAGGGTGCGGGCAGGTGCCGG - Intronic
1066656481 10:37702918-37702940 CTCAGGACCCGTTGCGGTGCTGG + Intergenic
1067286475 10:44911203-44911225 CTCAGGCGGCTGGGCTGCGCTGG + Exonic
1069856333 10:71443150-71443172 CCCAGGCCTCAGGGCGGTGGTGG - Intronic
1069988110 10:72297911-72297933 CTCAGGCCGCTGGGGAGGGCCGG - Intergenic
1070333024 10:75431468-75431490 GTCGGGGCGCGGGGCGCTGCGGG + Intronic
1073379321 10:103066048-103066070 CACAGGCCGCTGGGGGCTGCAGG - Intronic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1075616061 10:123891661-123891683 CCCTGGGCGCGGGGCGGAGCAGG - Exonic
1077886312 11:6390510-6390532 CTCAGGGCCCCGGGCGGCGCCGG - Exonic
1079163156 11:18012920-18012942 CTCCGCCCCCGGGCCGGTGCAGG - Intronic
1081637041 11:44727779-44727801 CCCTGGCAGCGGGGCGGGGCGGG + Intronic
1083616248 11:64028087-64028109 CTCAGGATGCGGGGCTGGGCAGG + Intronic
1083782243 11:64924645-64924667 TTCAGCCCGCGGGGAGGTGCGGG + Intronic
1083841754 11:65308774-65308796 CTCAGGCCACAGGGCCCTGCAGG + Intergenic
1084962973 11:72726883-72726905 CACAGGCCGTGGGGTGGGGCGGG + Exonic
1088604086 11:111512425-111512447 CGCGGGCCGAGGGGCGGGGCGGG - Intergenic
1088899319 11:114103284-114103306 CTCAGGCTGGGGGGTGGTGGGGG - Intronic
1090027624 11:123181212-123181234 CTCAGGCTGTGTGGCGGTGTTGG - Intronic
1090224731 11:125063236-125063258 CTCAGGCCGCGGGGCCAGGGCGG + Intronic
1090327779 11:125904188-125904210 GGCGGGCCGCGGGGCGGCGCGGG + Intronic
1090884129 11:130861458-130861480 CAGAGGCCGCGCGGCAGTGCTGG - Intergenic
1091394195 12:143550-143572 CACAGGCCCCAGGGCCGTGCTGG + Intronic
1094025648 12:25958332-25958354 CTCAGGCCTCGGTGCGTCGCGGG + Intergenic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1104690120 12:130819167-130819189 CTCAGGACCCGGGGCAGGGCTGG - Intronic
1105571088 13:21603758-21603780 CTCAGGCCGGGGGCCGGTCCAGG + Intronic
1106248364 13:27966908-27966930 CGCAGCCCGCGGGCCGGAGCCGG - Intronic
1112077771 13:95931709-95931731 CTCAGGCCGGCGGGCGCTGCCGG - Intronic
1113541792 13:111115190-111115212 CGCAGGGCGCGGGGCGGCGCGGG + Intronic
1113737744 13:112690285-112690307 CTCGGCGCGCCGGGCGGTGCAGG - Intergenic
1116018352 14:39432557-39432579 CGCAGGCCGCGGGGCGGGGCGGG + Intergenic
1117368274 14:55052084-55052106 GTCTGGCTGCGGGGCGGGGCGGG + Intronic
1119401204 14:74363906-74363928 CTCAGGCCCCAGGGCATTGCTGG + Intergenic
1122108986 14:99481672-99481694 CTGAGGCGCCGGGGCGGGGCAGG + Intronic
1126210110 15:46092341-46092363 CTGAGGCGGCGGGGGGGTGGGGG + Intergenic
1128322562 15:66703488-66703510 CCCAGGGCGCGGGGAGGCGCCGG + Exonic
1129150276 15:73684177-73684199 GTCAGGCCTGGGGGCGGGGCGGG + Intronic
1131113238 15:89778147-89778169 CTCAGACCCCCGGGAGGTGCTGG + Exonic
1132203760 15:99972629-99972651 CGCAGGCCGCGGGGCGAGGGTGG + Exonic
1132508978 16:327410-327432 CACAGGCCGCAGGGCTGAGCCGG - Intronic
1132887877 16:2190396-2190418 CTCAGGCCGCCTGGAGGGGCTGG - Intronic
1132937684 16:2489797-2489819 CTCAGGCAGCTGAGCGGTCCTGG + Intronic
1133188519 16:4116575-4116597 CTGGGGCTGCGGGGCGGGGCGGG + Intergenic
1133239782 16:4407621-4407643 CTCAGCACCCGGGGTGGTGCTGG - Exonic
1135766222 16:25179854-25179876 TACAGGCGGCGGGGCGGTGGGGG - Intergenic
1136375482 16:29862910-29862932 CTGAGGCCGCGCTGCGGGGCTGG - Exonic
1138651369 16:58463414-58463436 CACAGTCCGCGCGGCGGAGCGGG + Intronic
1138651425 16:58463594-58463616 CTCGGCCCGCGGGGCGGTGCCGG - Intronic
1141553202 16:84819854-84819876 CTGAGCCTGCGGGGCGGGGCCGG + Intergenic
1142352650 16:89587147-89587169 CTGAGGGGGCGGGGCGGGGCGGG - Intronic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142585061 17:967106-967128 CTCAGGCCTGGGGGCTGTGGGGG - Intronic
1145066783 17:19766691-19766713 CTCAGCCCACGGGGCGCTGCTGG + Intergenic
1146283515 17:31559755-31559777 CTCAGGCCGAGGGACAGCGCTGG - Intergenic
1146912565 17:36658048-36658070 CCAAGGCCCCGGGCCGGTGCGGG + Intergenic
1148225204 17:45894500-45894522 CTGAGGCCGGCGGGCGGCGCAGG - Exonic
1148760499 17:49997275-49997297 CACAGTCTGCGGGGCGGGGCAGG - Intergenic
1148830176 17:50426116-50426138 CTCCGCCGGCGGGGCGGGGCGGG - Intergenic
1149427619 17:56570235-56570257 CTCAGGCCTCGGGGCTGTGTGGG + Intergenic
1149678585 17:58488093-58488115 CCCGGGCCGGGGGGCGGTGGCGG - Exonic
1151660770 17:75516838-75516860 CTCAGGCCGAGCGGCTGCGCCGG + Exonic
1151705563 17:75765232-75765254 GTCCGGGCGCGGGGCGGGGCTGG - Exonic
1152535864 17:80950045-80950067 CCCAGGCCGTGCAGCGGTGCAGG - Intronic
1152915148 17:83030772-83030794 CAGAGGCCTCGGGGCGGTTCCGG + Intronic
1153382637 18:4455489-4455511 CCCAGGCCGCGGGGAGGCGCCGG + Intergenic
1153973769 18:10248803-10248825 CCCAGGCTGTGGGGCGATGCTGG - Intergenic
1154162561 18:11991003-11991025 CTCAGGCCGTGGAGCTGGGCAGG + Intronic
1154340763 18:13500321-13500343 CTCTGCCCGTGGGGCTGTGCGGG + Intronic
1154377902 18:13824035-13824057 CTCTGGCCGCTGTGCCGTGCTGG + Intergenic
1158939963 18:62398649-62398671 CTCAGGCCTGAGGGCTGTGCAGG + Intergenic
1159012925 18:63075272-63075294 CTCGGGCCGCGGGAGGGAGCTGG - Intergenic
1159040283 18:63318412-63318434 CGCAGGCCCCGCGGCGGCGCCGG + Exonic
1160508194 18:79438797-79438819 CTCAGGACGCAGGGTGGGGCGGG + Intronic
1160698271 19:494855-494877 CTGAGGCCCAGGGGCGGGGCTGG - Intronic
1160698297 19:494933-494955 CTGAGGCCCAGGGGCGGGGCTGG - Intronic
1160838849 19:1137274-1137296 CTCGGGCCGGGGTGCGGTGGGGG + Intronic
1160838862 19:1137301-1137323 CTCGGGCCGGGGTGCGGTGGGGG + Intronic
1160838875 19:1137328-1137350 CTCGGGCCGGGGTGCGGTGGGGG + Intronic
1160838898 19:1137382-1137404 CTCGGGCCGGGGTGCGGTGAGGG + Intronic
1160868264 19:1265699-1265721 CTCAGGCCCGGGGGTGGGGCGGG + Intronic
1160935419 19:1592427-1592449 CCCAGGCCGCGGCCCGGGGCAGG + Intronic
1161065815 19:2236759-2236781 CTCACGCCGCTGGGCGGGCCAGG + Exonic
1161266359 19:3366520-3366542 CGCCGGCCGCGGGGCGGGGGGGG + Intronic
1161399573 19:4061375-4061397 CACAGGCCGCTGGGCGGGGAGGG - Intronic
1161558598 19:4958139-4958161 CTCAGGCCACAGGGCGAGGCAGG - Intronic
1161764580 19:6199667-6199689 CGCAGGACGCGGGGAGGGGCGGG - Intergenic
1162131290 19:8527549-8527571 CCCAGGCAGAGGGGTGGTGCTGG + Intronic
1162373692 19:10293116-10293138 CTCCGACGGCGGGGCCGTGCTGG + Exonic
1162926559 19:13933162-13933184 CGCAGGCGGCGGGGCAGGGCTGG + Exonic
1163668453 19:18613826-18613848 CTCAGGCCATGGGGAGGGGCAGG - Intronic
1163843950 19:19628273-19628295 CCCAGGTGGCGGGGCGGGGCAGG - Intronic
1164693115 19:30225699-30225721 CGCGGGGCGCGGCGCGGTGCGGG + Intergenic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1165242901 19:34481846-34481868 CCCTGGGCGCGGGGCGGGGCGGG - Exonic
1165443868 19:35845969-35845991 CTGAGGCCCGGGGGCGGGGCGGG - Intronic
1166121717 19:40690748-40690770 TTCAGGCCAAGGGGCGGGGCGGG - Intronic
1167464313 19:49642201-49642223 CTCCGGCCCCGGCGCGGGGCGGG - Exonic
1167577914 19:50326535-50326557 CTCAGGACGCGGCACGGTGGGGG + Intronic
1167594004 19:50418089-50418111 CTGAGGATGAGGGGCGGTGCGGG - Intronic
1167613295 19:50517552-50517574 CTGAGGCGGCGGGGCCGGGCGGG - Exonic
1167793126 19:51692774-51692796 CTCAGCCCGGGGGGCGCGGCAGG - Intergenic
1168336208 19:55599214-55599236 CTCAGGCTGCGGGGTGGAGGAGG - Intronic
925358950 2:3263713-3263735 CCCAGGACGCGGCACGGTGCCGG + Intronic
928170667 2:29001070-29001092 CTCTGGCCCCCGGGCAGTGCTGG + Intronic
930124039 2:47782891-47782913 CTCACGCCGCGGGGCTGGCCGGG - Intronic
932462710 2:71893726-71893748 CACAGGACGGGGGGCCGTGCTGG - Intergenic
934708888 2:96502734-96502756 CCCTGGACGAGGGGCGGTGCCGG + Intronic
934763491 2:96868671-96868693 CTCTGGCGGAGGGGCGGTGGGGG + Intronic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
941911729 2:170770909-170770931 CCCAGGCCGTAGGGCGGTGGAGG - Intergenic
1168830224 20:841601-841623 CAGAGGCCGCGGGGCAGGGCTGG - Intronic
1169327432 20:4686908-4686930 CGCAGGGCGCGGGGCGGGGAGGG + Intronic
1169367189 20:5001263-5001285 CGCAGGCCGCGCCGCGGGGCCGG + Intronic
1171461509 20:25300657-25300679 CTCAGGCCTCCGGGCACTGCAGG + Intronic
1175412107 20:58777227-58777249 CTCAGGCTGCAGGGCTGTCCAGG + Intergenic
1175715858 20:61253542-61253564 CCGAGGCCGCGGGGCGCTGGGGG + Intronic
1176380576 21:6110653-6110675 CGCAGGCCGCGTGGAGGGGCCGG + Intergenic
1178334342 21:31731160-31731182 CTCAGGCCGCGGCGCGTCGACGG - Intronic
1178334650 21:31732218-31732240 CCCTGCACGCGGGGCGGTGCAGG - Intergenic
1179500137 21:41803508-41803530 CAGAGGCCGCGGGGCAGTGGTGG + Intronic
1179522465 21:41954015-41954037 CTCTGGCCGCGGGGCGGGGCGGG + Intergenic
1179742896 21:43427587-43427609 CGCAGGCCGCGTGGAGGGGCCGG - Intergenic
1180131778 21:45831213-45831235 CTCACTCCTCGGGGCGGCGCCGG + Intronic
1180140653 21:45891840-45891862 CAGAGGCCCCGGGGCTGTGCAGG - Intronic
1180736970 22:18024463-18024485 CTCAGGCCGCGCGGCGAGGACGG + Exonic
1181026739 22:20131516-20131538 CCCGGGCCGCGGAGCCGTGCAGG - Intronic
1182301074 22:29337468-29337490 CTCAGGGGGTGGGGAGGTGCTGG + Intronic
1183487620 22:38097849-38097871 CACAGGGCAAGGGGCGGTGCTGG + Intronic
1184568844 22:45309798-45309820 ATCTGGCGGCGGGGCGGGGCGGG + Intronic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
953005905 3:38979014-38979036 CTCAGGCCTCAGGGCGCTGTGGG + Intergenic
953781846 3:45878243-45878265 TTCAGGCCTCGGGCTGGTGCTGG - Intronic
954110398 3:48429930-48429952 CTCCGGGCGCGGGGCGAGGCCGG - Intronic
955060832 3:55489992-55490014 CCCTGCCCGCGGGGCGGGGCTGG - Intergenic
960977955 3:123194769-123194791 CTGGGGCGGCGGGGCGGGGCGGG - Intronic
961028917 3:123585122-123585144 CCAGGGCCGCGGGGCGGAGCCGG + Exonic
961588634 3:127958105-127958127 CTCAGGGGCAGGGGCGGTGCAGG + Intronic
968478431 4:823656-823678 CTCAGGCCTCGGGGCTGTCGTGG - Intronic
968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG + Intronic
968508712 4:985330-985352 CTGAGGCCTCGGGGCTCTGCAGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968651990 4:1763816-1763838 CTCTGGCCGCGGGGCCGGGCCGG + Intergenic
968936735 4:3614921-3614943 CTCAGGCTTTGGGGAGGTGCTGG + Intergenic
968939749 4:3631588-3631610 CACAGGCCACGGGTCTGTGCGGG + Intergenic
968976024 4:3822414-3822436 GGCAGGCTGCGGGCCGGTGCGGG - Intergenic
970617452 4:17781424-17781446 CTGGGGCCACGCGGCGGTGCAGG - Exonic
971244142 4:24913114-24913136 CTGAGGGCGCGGGGCGGGCCCGG - Intronic
976199042 4:82561636-82561658 CGCAGGTCGCGGGGCAGAGCCGG + Intronic
984811139 4:183797499-183797521 CGCAGCCCGCGGGTCGCTGCGGG - Intergenic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
989631082 5:43483600-43483622 CCAGGGCCGCGGGACGGTGCCGG + Intronic
991474374 5:67004164-67004186 CCCAGGCTGCGGGGCTGTCCCGG + Intronic
992067318 5:73120217-73120239 CTCAGGCCTCGAGGGGGAGCGGG + Intergenic
994190693 5:96866536-96866558 CTCAGGCCCTGGGGCAGAGCTGG - Intronic
995725471 5:115177616-115177638 CTGGGGCTGCGGGGCGGGGCAGG + Intronic
995725724 5:115179254-115179276 CTCAGCAGGCGGGGTGGTGCCGG - Intronic
998176424 5:139904586-139904608 CTCGGGCCGCGGGGGCGTGTGGG + Intronic
1000318511 5:160115794-160115816 CTCAGGCTGCAGTGCAGTGCTGG - Intronic
1002105120 5:176876241-176876263 CTGGGACCGCGGGGCAGTGCAGG + Intronic
1002170314 5:177371039-177371061 TCCGGGCCGCGGGGCGGGGCGGG + Intronic
1002204704 5:177554421-177554443 AGCAGGCCGAGCGGCGGTGCGGG - Exonic
1002455954 5:179345438-179345460 CGCAGGGCGCGGGGCGGAGGAGG + Intergenic
1003871176 6:10404464-10404486 CCCCGGCCGCGGGGCGGGGCGGG + Intronic
1005526804 6:26659452-26659474 CCCAGGCCTAGGGGCGGCGCCGG - Exonic
1006547520 6:34792153-34792175 CTCACGCCGCGGCGAGGTGAGGG + Exonic
1007431513 6:41779903-41779925 CCGCGGCCGCGGGGCGGGGCGGG - Intronic
1007521626 6:42454555-42454577 CTCAGGTCCCTGGGCGGTGACGG - Intergenic
1018960160 6:168441872-168441894 GACAGTCCGCGGGGCGGCGCCGG - Intronic
1019070204 6:169339254-169339276 CTGAAGCCGCGGAGCCGTGCAGG + Intergenic
1019437149 7:1028173-1028195 CTGTCGCCGCGGGGCGGGGCTGG + Intronic
1022113081 7:27243249-27243271 CGCAGGCAGCGCGGCGGGGCCGG + Exonic
1022629374 7:32070899-32070921 CGCTGGGCGCGGGGCGGAGCCGG - Intronic
1025829805 7:65038755-65038777 CCCAGGCCGCGGGGCGGAGGTGG + Intergenic
1025917060 7:65873755-65873777 CCCAGGCCGCGGGGCGGAGGTGG + Intronic
1027224486 7:76235303-76235325 AGCAGGCCGCGGGGCGGGACTGG + Intronic
1033283452 7:140021849-140021871 GACAGGCCGGGGGGCGGGGCCGG - Intergenic
1034269808 7:149798021-149798043 CTCAGGGCCGGGGGCTGTGCAGG + Intergenic
1034331536 7:150287407-150287429 CTCAGGCTGCCTGTCGGTGCAGG - Intronic
1034666507 7:152822460-152822482 CTCAGGCTGCCTGTCGGTGCAGG + Intronic
1034977647 7:155457711-155457733 CTCGGGCCGCGGAGCTCTGCGGG + Intergenic
1035153207 7:156892622-156892644 CCGAGGCCGCGGGGCGGGGGCGG + Intronic
1035403916 7:158586746-158586768 CGCTGCCCGCGGGGGGGTGCGGG + Intronic
1035610738 8:962463-962485 CTGTGGCCGTGGGGCGCTGCTGG + Intergenic
1035752007 8:2002733-2002755 CGCAGGCGGCGGGGCCGAGCGGG + Exonic
1037450864 8:19014263-19014285 CTCCGGCCGCGGATCGGTGCCGG - Intronic
1041645174 8:60244056-60244078 CACAGTCCGAGGGGCGGTGGAGG - Intronic
1042565891 8:70111429-70111451 CTCAGCCCACGGGGAGGTCCTGG + Exonic
1042591423 8:70402589-70402611 CTCGGGCCCCTGGGGGGTGCTGG - Intronic
1045516316 8:102863683-102863705 GGCCGGCCGCGGGGCGCTGCGGG + Intronic
1049396711 8:142404208-142404230 CCCAGCCAGCGGGGCGGTGGGGG - Intergenic
1049454263 8:142679012-142679034 CCCAGCCCGCTGGGCGGTGGTGG - Intronic
1049657398 8:143804872-143804894 CAGAGGGCGCGGGGCGGGGCAGG + Intronic
1051484341 9:17592117-17592139 CTGAGGCCCCGGGGAGCTGCTGG + Intronic
1053476849 9:38388371-38388393 CTCAGGCCCCAGGGTGGTGTTGG + Intergenic
1054451013 9:65403722-65403744 CACAGGCCACGGGTCTGTGCGGG - Intergenic
1056560558 9:87726047-87726069 GCCAGGCGGCGGGGCGGTGCCGG + Exonic
1057682253 9:97199857-97199879 CCCAGGCCTAGGGGCGGCGCCGG - Intergenic
1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG + Exonic
1061453424 9:130681227-130681249 CTCTGGCCGCGGGGCGGGGCGGG - Exonic
1061802791 9:133121268-133121290 GTCAGGCTGGGGGGCGGGGCCGG + Intronic
1062542042 9:137045837-137045859 CGCAGGCCGCGGGGCGCCCCGGG - Intronic
1062688412 9:137828169-137828191 CACAGGCCCCAGGGGGGTGCTGG + Intronic
1062698273 9:137886328-137886350 CTCAGGCCACGGGGAGGAGGTGG + Intronic
1203782172 EBV:106664-106686 CCCAGACCGCAGGGCGGTGGTGG - Intergenic
1192784913 X:74326003-74326025 CTCAGGGGCCGGGGCGGGGCGGG - Intergenic
1192988608 X:76427607-76427629 CTCAGGCCCAGGGGAGGGGCGGG + Intergenic
1194666917 X:96685409-96685431 GTCAGCCCGGGAGGCGGTGCGGG + Intronic
1195460250 X:105115859-105115881 CTCAGGCATGGGGGCGCTGCAGG + Intronic
1200214212 X:154360278-154360300 CTCAGGCCCCGGGCTGGAGCGGG - Exonic
1200544086 Y:4497800-4497822 CTCAGGCCACGGGGCAGAGAGGG - Intergenic