ID: 917817562

View in Genome Browser
Species Human (GRCh38)
Location 1:178725693-178725715
Sequence GTCGCAGCGCCCCCGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917817562_917817569 8 Left 917817562 1:178725693-178725715 CCTGAAGCCGGGGGCGCTGCGAC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 917817569 1:178725724-178725746 CCCGCCTCGCTCTCCCTCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 208
917817562_917817571 11 Left 917817562 1:178725693-178725715 CCTGAAGCCGGGGGCGCTGCGAC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 917817571 1:178725727-178725749 GCCTCGCTCTCCCTCTTGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 167
917817562_917817573 14 Left 917817562 1:178725693-178725715 CCTGAAGCCGGGGGCGCTGCGAC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 917817573 1:178725730-178725752 TCGCTCTCCCTCTTGGGTGGCGG 0: 1
1: 0
2: 1
3: 14
4: 134
917817562_917817567 7 Left 917817562 1:178725693-178725715 CCTGAAGCCGGGGGCGCTGCGAC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 917817567 1:178725723-178725745 ACCCGCCTCGCTCTCCCTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917817562 Original CRISPR GTCGCAGCGCCCCCGGCTTC AGG (reversed) Intronic
901376793 1:8845387-8845409 GTCACAGCGCCCCATTCTTCTGG + Intergenic
901435994 1:9247718-9247740 GACGCAGGGCCCCCGCCTCCCGG - Intronic
903174895 1:21574978-21575000 GTCACAGAGCCCTCGGCTGCTGG + Intronic
906508056 1:46394522-46394544 GGCGCAGCGCTTCCGGCTCCAGG + Exonic
910887361 1:91978881-91978903 GTCTCAGCGCCCCCAGCAGCTGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
913300715 1:117366878-117366900 GTCCCATCGCCCCCGCCCTCCGG + Intergenic
913521287 1:119647888-119647910 GGCGCAGGGCCCCGGGCTTATGG - Intergenic
917817562 1:178725693-178725715 GTCGCAGCGCCCCCGGCTTCAGG - Intronic
924926851 1:248691987-248692009 CTCACAGCGCCCCCGGATGCTGG - Intergenic
1066480907 10:35794811-35794833 GGTGCAGGGCCCTCGGCTTCTGG + Intergenic
1071195808 10:83157930-83157952 GTCACAGCTCCCCAGGCTTCAGG - Intergenic
1073120773 10:101121488-101121510 AACGCAGAGCCCGCGGCTTCCGG - Intronic
1076999838 11:317044-317066 GGCGCAGTGCCCCAGGCTACAGG + Intergenic
1077116869 11:889129-889151 GCCGCAGCCGCCCCGGCCTCTGG - Intronic
1077358364 11:2128889-2128911 GTCCCAGACCCCCTGGCTTCAGG + Intergenic
1081927905 11:46846045-46846067 GCCGCAGGTCCCCCGGCCTCCGG + Intronic
1089614523 11:119687732-119687754 GTCTCAGCCCCGCAGGCTTCAGG + Intronic
1091838396 12:3601987-3602009 GCCCCAGGACCCCCGGCTTCAGG - Intergenic
1105413904 13:20193031-20193053 GGCGGAGCGCGCCCGGCCTCTGG + Intergenic
1122975573 14:105169314-105169336 GGCGCAGCGCCCCCTGCAGCCGG - Intergenic
1124392199 15:29269507-29269529 GTCGCAGGGCCCCTCGCCTCAGG - Exonic
1135783246 16:25324792-25324814 GTCTCAGCTCCCCTGGCTCCAGG - Intergenic
1142178180 16:88654596-88654618 GTCTCAGCGCCACAGCCTTCAGG + Intronic
1142227291 16:88883825-88883847 GTAGCTGCGCCCACGACTTCTGG + Intronic
1148892376 17:50817425-50817447 GTCTCAGCGCCCCCTGCTGGGGG - Intergenic
1150692750 17:67378862-67378884 GTCGCAGCCCCCGCCGCTCCCGG - Intronic
1150790351 17:68197295-68197317 GACGCAGCCCTCCCGGCTCCAGG + Intergenic
1151601703 17:75109979-75110001 GGCGCACCGTCCCCGGCTCCTGG - Exonic
1153363420 18:4224959-4224981 GTCACTGCTCCCCCAGCTTCAGG + Intronic
1160406183 18:78647830-78647852 GTCACAGTTCCCCAGGCTTCTGG - Intergenic
1160876272 19:1297634-1297656 ACCCCAGCGGCCCCGGCTTCAGG + Intronic
1161301511 19:3545049-3545071 GTGGCAGGGCCCCCAGCTCCTGG - Intronic
1161337658 19:3722893-3722915 GTCACACCGCCCCCGGGTACGGG - Intronic
1166317775 19:41998514-41998536 GACGCAGCCCCCCACGCTTCTGG - Exonic
925146614 2:1586993-1587015 CTCGCTGCGGCCCCGGCTCCTGG + Intergenic
926401500 2:12501666-12501688 GCCCCAGCACCCCCGGCTTTCGG - Intergenic
930872733 2:56184553-56184575 CTCGCCGCGCCCGCGCCTTCGGG + Exonic
932708762 2:74047217-74047239 GTGTCAGTGCCCCAGGCTTCAGG - Exonic
933772638 2:85754035-85754057 GCAGCTGCGCCGCCGGCTTCGGG - Exonic
938302972 2:130229223-130229245 ACCGCAGCGCCCGCGGCCTCCGG - Intergenic
944716104 2:202376972-202376994 GTCGCATCGCCCGCGGCTCCGGG - Exonic
948128532 2:235583091-235583113 GCCCCAGAGCCCCTGGCTTCTGG - Intronic
1169143606 20:3239065-3239087 CCCGCCGCGCCCCCGGGTTCAGG + Intronic
1173817715 20:46000451-46000473 ATCCCAGCACCCCCGGCTTCAGG + Intergenic
1176194476 20:63831000-63831022 CTCGCAGCGGCCCCGGCTCCCGG + Intronic
1180082535 21:45493413-45493435 GTCACAGCGGCCCTGCCTTCGGG + Intronic
1182903837 22:33920415-33920437 GCGGCCGCGCCCCCAGCTTCGGG + Exonic
1185395235 22:50583262-50583284 GTCGGAGCGCCCCAGGGGTCGGG - Intronic
954812272 3:53255665-53255687 CTCGCAGGGCCCCGGGCTGCAGG - Intronic
954882696 3:53846408-53846430 GTCGCAGCGCCCTCGCCTGCTGG - Intergenic
960691337 3:120349297-120349319 GCCGCAGAGCTCCCGGCCTCTGG - Exonic
971457345 4:26857592-26857614 GCCGCTGCCCGCCCGGCTTCCGG - Intergenic
972570859 4:40309348-40309370 TTCACAGGGCCCCTGGCTTCAGG - Intergenic
976758420 4:88523305-88523327 GACGCAGCTCCCCTGGCCTCCGG + Intronic
985876084 5:2596973-2596995 GCCGTTGCGCCCCCGGCTTCTGG - Intergenic
995797907 5:115961697-115961719 GTCCCCTCTCCCCCGGCTTCAGG + Intergenic
999809566 5:155114931-155114953 GCCGCCGCGCCCCCGGCTCTGGG + Intergenic
1002568771 5:180128547-180128569 GGCGCAGAGCCGCCAGCTTCTGG + Exonic
1006576282 6:35048858-35048880 GTCGCTCAGCCCCCGGCTCCTGG + Intronic
1007721949 6:43890466-43890488 GACACAGGGGCCCCGGCTTCAGG + Intergenic
1009771132 6:68144473-68144495 GTCACTCCGCCCCCAGCTTCAGG - Intergenic
1020046708 7:5046059-5046081 GCCCCAGCGCCGCCGGCTCCGGG - Exonic
1020278346 7:6637635-6637657 GCGGCAGCGCCCCCGCCTCCCGG + Intronic
1026522875 7:71132010-71132032 CTCACAGCGCCGCCGGCTCCCGG - Intergenic
1026898715 7:74025712-74025734 GACACAGGGCCCCCGGCCTCAGG + Intergenic
1027116567 7:75486079-75486101 GCCCCAGCGCCGCCGGCTCCGGG + Exonic
1027232662 7:76281736-76281758 GCCGCGGCGCCCCCGGCCCCGGG + Exonic
1027275234 7:76549531-76549553 GCCCCAGCGCCGCCGGCTCCGGG - Intergenic
1029720943 7:102364081-102364103 GCCCCAGCGCCGCCGGCTCCGGG - Exonic
1032108143 7:129052185-129052207 GTCACTGTGCCCCTGGCTTCCGG + Intronic
1032782010 7:135170930-135170952 GAGGCAGCGCCACCGGCTTGAGG + Intergenic
1036723610 8:11200643-11200665 GGCGCTGCGCCCCCGGCGTGGGG + Exonic
1045571332 8:103371641-103371663 GTCGCATGGCTCCCGGCTGCCGG - Exonic
1053904275 9:42825720-42825742 GAGGCAGCGCCCCAGGCTCCAGG + Intergenic
1054366008 9:64342772-64342794 GAGGCAGCGCCCCAGGCTCCAGG + Intergenic
1054530709 9:66179794-66179816 GAGGCAGCGCCCCAGGCTCCAGG - Intergenic
1054673636 9:67832501-67832523 GAGGCAGCGCCCCAGGCTCCAGG + Intergenic
1060470022 9:123940822-123940844 GTGGAAGCTCCCCCTGCTTCTGG + Intergenic
1060996645 9:127877812-127877834 GTCGCCGCGCACCCGGGCTCGGG - Intergenic
1185610542 X:1391752-1391774 GTCCACGCGCCGCCGGCTTCCGG - Intronic
1185735017 X:2489783-2489805 ACAGCAGCGCCCCCAGCTTCGGG + Exonic
1190626540 X:52343318-52343340 CTCGCAGCGCCCCGGCCTCCTGG + Intergenic
1200143330 X:153912991-153913013 GTCGCAGGGCCCCAGCCCTCAGG + Intronic