ID: 917829895

View in Genome Browser
Species Human (GRCh38)
Location 1:178871096-178871118
Sequence ACTTGAGTCTACTGAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 205}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917829895_917829900 19 Left 917829895 1:178871096-178871118 CCTCTTTCTCAGTAGACTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 917829900 1:178871138-178871160 ACCAAAAATTGCTGGAGACTGGG 0: 1
1: 0
2: 1
3: 28
4: 227
917829895_917829902 20 Left 917829895 1:178871096-178871118 CCTCTTTCTCAGTAGACTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 917829902 1:178871139-178871161 CCAAAAATTGCTGGAGACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 303
917829895_917829905 25 Left 917829895 1:178871096-178871118 CCTCTTTCTCAGTAGACTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 917829905 1:178871144-178871166 AATTGCTGGAGACTGGGGGCGGG 0: 1
1: 0
2: 1
3: 94
4: 2215
917829895_917829903 21 Left 917829895 1:178871096-178871118 CCTCTTTCTCAGTAGACTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 917829903 1:178871140-178871162 CAAAAATTGCTGGAGACTGGGGG 0: 1
1: 0
2: 3
3: 38
4: 383
917829895_917829904 24 Left 917829895 1:178871096-178871118 CCTCTTTCTCAGTAGACTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 917829904 1:178871143-178871165 AAATTGCTGGAGACTGGGGGCGG 0: 1
1: 0
2: 3
3: 62
4: 602
917829895_917829899 18 Left 917829895 1:178871096-178871118 CCTCTTTCTCAGTAGACTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 917829899 1:178871137-178871159 CACCAAAAATTGCTGGAGACTGG 0: 1
1: 0
2: 0
3: 14
4: 147
917829895_917829898 11 Left 917829895 1:178871096-178871118 CCTCTTTCTCAGTAGACTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 917829898 1:178871130-178871152 ATTACATCACCAAAAATTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917829895 Original CRISPR ACTTGAGTCTACTGAGAAAG AGG (reversed) Intronic
901743063 1:11355123-11355145 CCTTGAAGCTACAGAGAAAGAGG - Intergenic
902716874 1:18279114-18279136 ACTTGATTCTTCTAAGCAAGCGG + Intronic
904834725 1:33328049-33328071 ACTGCAGTCTCTTGAGAAAGAGG + Intronic
905716545 1:40156285-40156307 ACTCCAGTCTAGTGACAAAGGGG + Intergenic
907465880 1:54636500-54636522 ACTTCCATCTACTGAGATAGGGG - Exonic
907695592 1:56724749-56724771 ACTTGGGTCATCTTAGAAAGTGG + Intronic
907710428 1:56875774-56875796 ACTGGAGGATACTGAGCAAGGGG + Intronic
909885277 1:80934386-80934408 AGTTCAGTACACTGAGAAAGAGG + Intergenic
910839371 1:91546746-91546768 ACTTGGGGCTTCTGAGAGAGAGG - Intergenic
911857981 1:102905560-102905582 CTATGAGTCAACTGAGAAAGAGG - Intronic
913538293 1:119795276-119795298 ACATGAATCAACTGAGAATGAGG + Intronic
915765169 1:158355160-158355182 ACTAGAGTTTACTGGCAAAGGGG - Intronic
916751452 1:167726124-167726146 GCTTGAATATAGTGAGAAAGGGG - Intronic
917829895 1:178871096-178871118 ACTTGAGTCTACTGAGAAAGAGG - Intronic
919103920 1:193125689-193125711 ACCTCAGTCTCCTGAGAAACTGG + Intronic
919267351 1:195286726-195286748 ACTTAACTTTACTGAGAAACTGG - Intergenic
920044823 1:203126562-203126584 AGTTGAGTCTTCTGAGGAGGAGG - Intronic
921616550 1:217274580-217274602 ACTTTAGTTTCCTGAGAAATTGG - Intergenic
923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG + Intronic
923467373 1:234261336-234261358 ATTTGAGTTTTCTGGGAAAGGGG + Intronic
924050433 1:240075036-240075058 TCATGAGTTTTCTGAGAAAGGGG + Intronic
1064065691 10:12179402-12179424 ACTAAAGTTTTCTGAGAAAGCGG - Intronic
1071073610 10:81725622-81725644 ACTTGAGTCTACTCACCCAGTGG + Intergenic
1071082218 10:81825938-81825960 TCATGAGTTTTCTGAGAAAGGGG + Intergenic
1071704518 10:87982753-87982775 ACTTGAGTTTTAAGAGAAAGAGG - Intergenic
1073791969 10:106949585-106949607 AATTGTGTCTCCTGAGAAAATGG + Intronic
1074437139 10:113443869-113443891 AATTGAGGCTTCTGGGAAAGTGG - Intergenic
1077041909 11:528548-528570 ACCTGAGTCCACCGAGGAAGGGG + Intergenic
1077873836 11:6285910-6285932 AATTGAGACTACTGAGGAAACGG + Intergenic
1079243523 11:18737315-18737337 ACTTGAATATACTGAGTAATGGG + Intronic
1079788751 11:24709692-24709714 ACATAACTCTACTGATAAAGAGG + Intronic
1080805229 11:35647196-35647218 TCTTGGGACTTCTGAGAAAGAGG - Intergenic
1085957104 11:81411957-81411979 ACATAAATCTACTGAGAATGTGG + Intergenic
1086051605 11:82598457-82598479 ACTTCAGTCTACTGAGAGCCAGG + Intergenic
1087636872 11:100711657-100711679 ATTTAAGTTTACTGAGAAAAGGG - Intronic
1088027474 11:105203679-105203701 ACTGGACTCCACTTAGAAAGTGG - Intergenic
1088463985 11:110113584-110113606 ACTTCATTAGACTGAGAAAGGGG + Intronic
1089472840 11:118734711-118734733 ACATGAGTTTTCTGGGAAAGGGG - Intergenic
1090112990 11:123936134-123936156 AGTTCAGTCTCCCGAGAAAGTGG + Intergenic
1092142380 12:6192806-6192828 ACAGGAGTGTCCTGAGAAAGAGG + Intergenic
1094504359 12:31048937-31048959 AGTTGTGGCTACGGAGAAAGAGG + Intergenic
1096176261 12:49521634-49521656 ACTTCAGTACACTGAAAAAGTGG - Intronic
1096539788 12:52300509-52300531 ACTTGACTCTCCTGGGAAATAGG - Intronic
1097679597 12:62636357-62636379 ACTTCAGTCTTCTGAGTAGGTGG + Intergenic
1097745198 12:63293873-63293895 ACTTAAGGCCACTGAGAGAGGGG + Intergenic
1100710894 12:97255754-97255776 ACTGGCCTCTTCTGAGAAAGAGG - Intergenic
1102623553 12:114216477-114216499 CTTTGAGCCAACTGAGAAAGTGG - Intergenic
1104287589 12:127439174-127439196 ACTGGAGTTCACAGAGAAAGAGG + Intergenic
1104808546 12:131605336-131605358 TCATGAGTCTTCTGGGAAAGGGG - Intergenic
1106739518 13:32624749-32624771 AATTGCTTCTACTGAGAAATAGG + Intronic
1107020446 13:35745658-35745680 TCTTGAGTTTTCTGAAAAAGGGG + Intergenic
1108596397 13:51953750-51953772 ACTTGTGTTTAATGAGGAAGGGG - Intronic
1108771877 13:53712573-53712595 ACTTGAGACTTCTGACAAAATGG - Intergenic
1109561047 13:64050697-64050719 ATTGGAATCTATTGAGAAAGAGG + Intergenic
1110747485 13:79071490-79071512 ATTTAAGTATACTGAGAAAATGG + Intergenic
1114229560 14:20768261-20768283 ACTTGAGTTTATTCAGACAGTGG - Intergenic
1115998081 14:39214109-39214131 ACTTCAGTCTGCTGAGAAGCTGG - Intergenic
1116537670 14:46055653-46055675 GCTTCAGCCTACTGAGAAAATGG + Intergenic
1116989892 14:51264348-51264370 CCCTGAGTCTGCTGAGAATGGGG + Intergenic
1118878703 14:69808128-69808150 ACTTGAGTCGCCTGAAAAAATGG - Intergenic
1119885231 14:78134752-78134774 ACTTGAGCATAGTGAGCAAGGGG - Intergenic
1120409024 14:84127876-84127898 GTTTGAGTTTACTGATAAAGGGG - Intergenic
1125981687 15:44008054-44008076 ACTTCAGCCTACTGAGTAGGTGG + Intronic
1126080307 15:44954678-44954700 ACTTGAGTCGACTGAGTATTTGG + Intergenic
1126348710 15:47722267-47722289 ACTTGAGTCTACTTGAAAAGGGG + Intronic
1127305470 15:57701351-57701373 TCTCGAGTATACTGAGAAAGAGG - Intronic
1128465708 15:67909333-67909355 TCATGAGTTTACTGGGAAAGGGG - Intergenic
1129659788 15:77546811-77546833 ACTTCAGCCTCCTGAGTAAGTGG - Intergenic
1130189844 15:81723433-81723455 ACTTGAGTCTAAATAGAAAATGG - Intergenic
1132427278 15:101728630-101728652 ACTTGAATGTACTCAGAGAGTGG - Intergenic
1132754721 16:1477401-1477423 CCTTGAGTCCACTCATAAAGGGG + Intergenic
1138010717 16:53376882-53376904 ACTTGAGTCAACTGAGTATTTGG - Intergenic
1138727576 16:59156892-59156914 ACTTGAGTTCACTGAGGCAGAGG - Intergenic
1141484381 16:84329145-84329167 AATTGGGTCTTCTCAGAAAGGGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146436449 17:32853201-32853223 AAGTGAGACTAGTGAGAAAGTGG - Intronic
1147918083 17:43900486-43900508 CCTGGAGTCTTCTGAGGAAGCGG - Intronic
1148100855 17:45090167-45090189 ACCTCAGTCTCCTGAGAAACTGG - Intronic
1148711260 17:49682928-49682950 ACTTGAGTCTCCAGACAAGGGGG - Intergenic
1149661004 17:58333793-58333815 CCTTGAGTCTAAAGAGAAAGTGG + Intergenic
1149799516 17:59554129-59554151 ACTTCAGCCTCCTGAGAAATTGG - Intergenic
1151052052 17:70989457-70989479 TCATGAGTTTTCTGAGAAAGGGG + Intergenic
1154331682 18:13434865-13434887 ACCACTGTCTACTGAGAAAGAGG - Intronic
1157724579 18:49954253-49954275 CATTGAGTCTACTTAGAGAGGGG + Intronic
1160340349 18:78084151-78084173 ACTTTCCTCTTCTGAGAAAGTGG + Intergenic
1161653211 19:5497858-5497880 ACTTGATTCTGCTGAGGATGAGG - Intergenic
1161833487 19:6628165-6628187 ACCTGAGTCTACTGAGTTATTGG - Intergenic
1163046766 19:14648742-14648764 ACTAAGGTCTCCTGAGAAAGAGG + Intronic
1164469775 19:28520212-28520234 CCTTTAGTCTAATGAGAAGGAGG + Intergenic
1168511958 19:56980123-56980145 GCTTCCGTCTACTGAGACAGGGG + Intergenic
928164043 2:28956623-28956645 ACTTCACTTTACTGAGAAACAGG - Intronic
928864153 2:35896631-35896653 AATTGAGTTTACTAAGAAACAGG - Intergenic
929997631 2:46838809-46838831 TCTTGAGTCTTCTGAGAGAGAGG + Intronic
930989692 2:57637912-57637934 ACTTTTGTCTTCTGAGAAATGGG + Intergenic
931363041 2:61594872-61594894 ACCTGAGTCTCCTGAGTAAATGG + Intergenic
932070277 2:68612904-68612926 TCTTGAGTTTTCTGGGAAAGGGG + Intronic
933099280 2:78231278-78231300 ACATGAGTCTGGTGAAAAAGCGG + Intergenic
935422140 2:102880271-102880293 ACTGAAGTCCCCTGAGAAAGAGG - Intergenic
937419001 2:121739174-121739196 ACTGGGGTGTACAGAGAAAGTGG - Intronic
939292233 2:140211526-140211548 TCATGAGTTTTCTGAGAAAGGGG + Intergenic
940512584 2:154637390-154637412 ACTTGTTTTTACTGAGAAATGGG + Intergenic
940653911 2:156465474-156465496 ACTTCAGTCTCCTGAGTAACTGG + Intronic
941248594 2:163132785-163132807 TCTTGAGTATACTGGGAAAATGG + Intergenic
941473872 2:165923864-165923886 ACTTCAGTCTCCTGAGTAACTGG + Intronic
944568628 2:201019283-201019305 ACCTGTTGCTACTGAGAAAGAGG - Intronic
945028805 2:205644287-205644309 AATAGAGACTACTGAGAGAGAGG - Intergenic
945068202 2:205965045-205965067 ACTTCAGTCTCCTGAGTAATTGG + Intergenic
945624624 2:212187097-212187119 ACTTGACTCTACTGTTAAAAGGG + Intronic
946858341 2:223976007-223976029 ACTGGACACTACTGAGCAAGAGG - Intronic
948762595 2:240201440-240201462 CCTTGAGCCTCCTGAGAAAGGGG + Intergenic
1169015334 20:2288103-2288125 ACTTTAGTAAACTGAGAAAATGG + Intergenic
1169323086 20:4651394-4651416 ACATGAGGCTCCTGAGAAGGTGG - Intergenic
1170376964 20:15710807-15710829 ACTGGAGGCTACTTAGAAACCGG - Intronic
1170478594 20:16742805-16742827 ATTTGAGGCTATTAAGAAAGTGG + Intergenic
1170948429 20:20912404-20912426 ACCTCAGCCTCCTGAGAAAGGGG + Intergenic
1172870720 20:38134016-38134038 ACCTGAGTCTACTGCTAAAGAGG + Intronic
1174294489 20:49535595-49535617 ACTTGAGCCTGGTGAGACAGAGG - Intronic
1175521047 20:59603237-59603259 CCTTGAGTCTTCCGGGAAAGGGG - Intronic
1176824357 21:13687985-13688007 ACTTCAGTCTCCTGAGTAACTGG - Intergenic
1177079452 21:16620255-16620277 ACATGTGTCTACTGAGAACTTGG + Intergenic
1177609882 21:23432600-23432622 TCTTGAGTCTACCCAGAATGTGG + Intergenic
1178313061 21:31545585-31545607 ACTAGTGTCTAAGGAGAAAGGGG + Intronic
1178589435 21:33896646-33896668 ACTTGAGGCTACTTACACAGAGG - Exonic
1178993318 21:37373814-37373836 ATTTGGGTCTACTGAAGAAGGGG + Intronic
949622481 3:5829799-5829821 ACTTGTGTCCATTCAGAAAGTGG + Intergenic
950365878 3:12483855-12483877 GCTTGAGTTTACTGAAAAATGGG - Intergenic
950461892 3:13128434-13128456 CCTTTAGCCTGCTGAGAAAGTGG + Intergenic
951519169 3:23595229-23595251 ACTTGAAACTACTGACAAACAGG + Intergenic
951738509 3:25894701-25894723 ACTAGATTCTAGTGAGAATGGGG - Intergenic
953795584 3:45983400-45983422 AGTGGAGGGTACTGAGAAAGTGG + Intronic
955097097 3:55809924-55809946 TCTTGAGTCTAGTGTCAAAGGGG + Intronic
955974582 3:64467888-64467910 TGTTGGGACTACTGAGAAAGTGG + Intergenic
959859098 3:111196415-111196437 ATTTTAGACTACTGTGAAAGAGG - Intronic
963163369 3:142175369-142175391 AAAGGAATCTACTGAGAAAGGGG - Intronic
964955389 3:162349346-162349368 TCTTGAGCCTAATGAGAATGAGG + Intergenic
966121473 3:176526235-176526257 ACTTGAGTCCATTGAGAAGTGGG + Intergenic
968948885 4:3680040-3680062 ATATAAGTCTACTGAGCAAGCGG - Intergenic
970328381 4:14953081-14953103 ACTAGATTATACTGAGAAAATGG + Intergenic
972024453 4:34360178-34360200 ACTTGAGACTACTGCAAAAACGG - Intergenic
973138967 4:46742453-46742475 ACTTGAATATATTGTGAAAGGGG - Intronic
973634636 4:52850734-52850756 AGTAGAGCCTACTGAGAAATGGG + Intergenic
974007788 4:56576222-56576244 ACTTGAGACTATTCAGAAGGTGG + Intronic
974281723 4:59804074-59804096 ACCTGAGGCTACAGAGAAAAAGG + Intergenic
974923020 4:68265430-68265452 TCATGAGTTTTCTGAGAAAGAGG - Intergenic
975115969 4:70681211-70681233 ACTTGATTCTATAGAGAATGAGG + Intronic
981213217 4:142133190-142133212 GATTGAGTGTACAGAGAAAGGGG - Intronic
981561610 4:146054388-146054410 ACGTGAGACTATTGAAAAAGTGG + Intergenic
982061669 4:151610562-151610584 AAGTGAGTCTACAGAGAAGGAGG - Intronic
985351508 4:189067936-189067958 ACTTGGTTCTACTAATAAAGGGG + Intergenic
989114446 5:37938843-37938865 ACTCAAGTTTAGTGAGAAAGAGG + Intergenic
989524969 5:42442684-42442706 ACTGGAATCTCCTGAGAAACTGG - Intronic
990079743 5:51898854-51898876 TGTTGAGTAGACTGAGAAAGAGG + Intergenic
990209253 5:53464672-53464694 AGCTGAGGCAACTGAGAAAGTGG - Intergenic
992739854 5:79762740-79762762 ACTTGTGTGTACTGGGACAGGGG + Intronic
993016380 5:82539220-82539242 ACTCTAGTCTTCTGAGGAAGAGG - Intergenic
993040975 5:82814392-82814414 ACCTGAGTTTTCTGAGAAAATGG - Intergenic
995752065 5:115462460-115462482 ACTTGGGGCTACAGAGATAGGGG + Intergenic
996836169 5:127795173-127795195 ACCTCAGTCTCCTGAGTAAGTGG - Intergenic
998179342 5:139925649-139925671 TCTTGAGCCAACTGAGAGAGGGG + Intronic
1000797072 5:165677692-165677714 AATATAGTCTACTGAGAAAATGG + Intergenic
1001442915 5:171759235-171759257 TATTGAGACTATTGAGAAAGAGG + Intergenic
1002023334 5:176380102-176380124 CCTTGAGGCTAATGAAAAAGGGG - Exonic
1003611711 6:7620266-7620288 ACTCGTGTCTCCTGAGCAAGAGG - Intergenic
1004309853 6:14535493-14535515 ACTTGGCTCTACTGAGACATTGG - Intergenic
1004850096 6:19690542-19690564 TCATGAGTCTTCTGGGAAAGGGG - Intergenic
1005515710 6:26552207-26552229 TCATGACGCTACTGAGAAAGGGG - Intergenic
1005559675 6:27025766-27025788 ACTGGAGTTTCCTGAGGAAGAGG - Intergenic
1006392602 6:33767443-33767465 CCTTGAGTCTCCATAGAAAGAGG - Intergenic
1006559859 6:34901623-34901645 ACCTGAGTCTACTGAGTAGCTGG + Intronic
1006813435 6:36835679-36835701 ACCTCAGTCTACTGAGTAACTGG - Intronic
1008406853 6:51127672-51127694 AATTAAGTCTGCTCAGAAAGGGG - Intergenic
1011077936 6:83458003-83458025 ACTTGACTCCACTGAGGCAGAGG - Intergenic
1014467171 6:121770990-121771012 ATTAGAGTCTAATGAGAGAGAGG - Intergenic
1015633482 6:135253816-135253838 TCTTGAGTTTTCTGGGAAAGGGG + Intergenic
1016928651 6:149380123-149380145 ACCTCAGTCTACTGAGTAACTGG - Intronic
1018848267 6:167570251-167570273 AGTTGAGTGCACTGAGACAGAGG - Intergenic
1022117469 7:27274899-27274921 AGTTGAGACTACACAGAAAGGGG + Intergenic
1028420635 7:90628718-90628740 CCTTGAGTCTCCTGAGTAACTGG - Intronic
1033924712 7:146443978-146444000 AGTTTATTCTACTGAGAAAATGG - Intronic
1035478988 7:159166912-159166934 ACCTGAGAATACTGAGAAAATGG - Intergenic
1037633521 8:20679216-20679238 ACTGTAGTCTGCTGAGAAAGAGG + Intergenic
1042200366 8:66275181-66275203 ACTTGAGTGCAGTGAGAAAGGGG - Intergenic
1042999392 8:74738742-74738764 ACTTTAGACTCATGAGAAAGAGG + Intronic
1045443365 8:102237246-102237268 ATGTGAATCTTCTGAGAAAGGGG - Intronic
1046011626 8:108555657-108555679 ATTTGAGAATACTGTGAAAGTGG - Intergenic
1047107459 8:121748936-121748958 ACTTGACCCTACAGAGAAATGGG - Intergenic
1047414968 8:124657044-124657066 ATTTGAGTCAACTGGGAAAATGG + Intronic
1051544207 9:18255841-18255863 CCCTGAGTCTTCTGACAAAGAGG - Intergenic
1052221287 9:26026430-26026452 ACTTAACTCCACTGAGACAGGGG + Intergenic
1052512665 9:29441358-29441380 ACCTCAGACTTCTGAGAAAGAGG - Intergenic
1055337901 9:75251637-75251659 ATCTGAGTCTGCTGAGCAAGTGG + Intergenic
1055518036 9:77052869-77052891 TCATGAGTTTACTGGGAAAGGGG + Intergenic
1056988190 9:91385156-91385178 ACTTCAGTCTCCTGAGTAACTGG + Intergenic
1057888714 9:98851792-98851814 TCATGAGTTTTCTGAGAAAGGGG + Intergenic
1058103737 9:100946427-100946449 ACTTCAGCCTCCTGAGAAATTGG + Intergenic
1058986530 9:110213179-110213201 ACTTGACTCTAGAGAGCAAGGGG - Intergenic
1060766268 9:126296794-126296816 ACTGGAGTGGACTGAGGAAGGGG - Intergenic
1060960287 9:127675989-127676011 AACTGAGACAACTGAGAAAGAGG + Intronic
1061310972 9:129762251-129762273 CTTGGAGGCTACTGAGAAAGTGG - Intergenic
1203523002 Un_GL000213v1:61573-61595 ACTTCAGTCTCCTGAGTAACTGG + Intergenic
1185785975 X:2891238-2891260 TCTTGAGTTTTCTGGGAAAGGGG + Intergenic
1188158310 X:26769443-26769465 ACCTGATTCTTCTGAGAGAGTGG + Intergenic
1189059406 X:37737032-37737054 ACATGTGACTACTGAGCAAGTGG + Intronic
1189315660 X:40054456-40054478 ACTTTATTTTGCTGAGAAAGAGG - Intronic
1192265537 X:69534952-69534974 ACTTGATTCTACAGACAATGTGG - Intergenic
1194190281 X:90826747-90826769 ATTTGAGTATATTAAGAAAGTGG + Intergenic
1195321657 X:103726142-103726164 ACATGGATCTACTGGGAAAGAGG - Intronic
1195416371 X:104623980-104624002 ACTTGAGTATACTTTGTAAGTGG + Intronic
1195588521 X:106596762-106596784 CCTTGAGGCTACAGAGAAAAGGG + Intergenic
1195918931 X:109963261-109963283 ACTTGTGTCTCCTGAGAGAGGGG + Intergenic
1196387592 X:115175249-115175271 ACTTGCCTCTAGTGAGAATGAGG - Intronic
1196388507 X:115185881-115185903 ACAGGATTCTACTGAAAAAGGGG + Intronic
1199175439 X:144783309-144783331 ACTTCAGTCTAATGAGTAAAAGG + Intergenic
1200536876 Y:4408848-4408870 ATTTGAGTATATTAAGAAAGTGG + Intergenic
1201287955 Y:12395124-12395146 TCTTGAGTTTTCTGGGAAAGGGG - Intergenic