ID: 917836016

View in Genome Browser
Species Human (GRCh38)
Location 1:178942119-178942141
Sequence CGGGGGAAACAGGATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917836016_917836027 0 Left 917836016 1:178942119-178942141 CCTTCCCCATCCTGTTTCCCCCG No data
Right 917836027 1:178942142-178942164 GGTCACCCCTGCCACTTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917836016 Original CRISPR CGGGGGAAACAGGATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr