ID: 917837636

View in Genome Browser
Species Human (GRCh38)
Location 1:178953636-178953658
Sequence TGGTGCCTTCTCTGCGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917837636_917837646 6 Left 917837636 1:178953636-178953658 CCCCACCCGCAGAGAAGGCACCA No data
Right 917837646 1:178953665-178953687 CCCTCCCTCGGAGCATCCGCAGG No data
917837636_917837650 21 Left 917837636 1:178953636-178953658 CCCCACCCGCAGAGAAGGCACCA No data
Right 917837650 1:178953680-178953702 TCCGCAGGACTGTGCTCATCTGG No data
917837636_917837641 -6 Left 917837636 1:178953636-178953658 CCCCACCCGCAGAGAAGGCACCA No data
Right 917837641 1:178953653-178953675 GCACCACCGCCTCCCTCCCTCGG No data
917837636_917837652 22 Left 917837636 1:178953636-178953658 CCCCACCCGCAGAGAAGGCACCA No data
Right 917837652 1:178953681-178953703 CCGCAGGACTGTGCTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917837636 Original CRISPR TGGTGCCTTCTCTGCGGGTG GGG (reversed) Intergenic
No off target data available for this crispr