ID: 917839900

View in Genome Browser
Species Human (GRCh38)
Location 1:178969383-178969405
Sequence CTGTGTTACGCTCAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917839895_917839900 -3 Left 917839895 1:178969363-178969385 CCCTGGGAGGCAATGACCTGCTG No data
Right 917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG No data
917839885_917839900 26 Left 917839885 1:178969334-178969356 CCCCTTTGGATTGGGTGGTCAGG No data
Right 917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG No data
917839887_917839900 25 Left 917839887 1:178969335-178969357 CCCTTTGGATTGGGTGGTCAGGG No data
Right 917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG No data
917839889_917839900 24 Left 917839889 1:178969336-178969358 CCTTTGGATTGGGTGGTCAGGGA No data
Right 917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG No data
917839896_917839900 -4 Left 917839896 1:178969364-178969386 CCTGGGAGGCAATGACCTGCTGT No data
Right 917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917839900 Original CRISPR CTGTGTTACGCTCAGGAGGT TGG Intergenic
No off target data available for this crispr