ID: 917846874

View in Genome Browser
Species Human (GRCh38)
Location 1:179026585-179026607
Sequence TGCAGGTCACTCGCGCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917846874_917846882 -3 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846882 1:179026605-179026627 GCAGGCCGGAGGCGGAAGGCGGG 0: 1
1: 0
2: 2
3: 55
4: 443
917846874_917846885 11 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846885 1:179026619-179026641 GAAGGCGGGGCAACCGTGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 114
917846874_917846886 12 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846886 1:179026620-179026642 AAGGCGGGGCAACCGTGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 69
917846874_917846892 29 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846892 1:179026637-179026659 CCCGGGGCCCGCGGTCTCCTGGG 0: 1
1: 0
2: 3
3: 18
4: 199
917846874_917846894 30 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846894 1:179026638-179026660 CCGGGGCCCGCGGTCTCCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 163
917846874_917846888 20 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846888 1:179026628-179026650 GCAACCGTGCCCGGGGCCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 129
917846874_917846883 -2 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846883 1:179026606-179026628 CAGGCCGGAGGCGGAAGGCGGGG 0: 1
1: 0
2: 0
3: 24
4: 311
917846874_917846887 13 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846887 1:179026621-179026643 AGGCGGGGCAACCGTGCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 71
917846874_917846879 -7 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846879 1:179026601-179026623 ACCTGCAGGCCGGAGGCGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 205
917846874_917846890 28 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846890 1:179026636-179026658 GCCCGGGGCCCGCGGTCTCCTGG 0: 1
1: 0
2: 4
3: 37
4: 294
917846874_917846881 -4 Left 917846874 1:179026585-179026607 CCGGGAAGCGCGAGTGACCTGCA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 917846881 1:179026604-179026626 TGCAGGCCGGAGGCGGAAGGCGG 0: 1
1: 0
2: 2
3: 31
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917846874 Original CRISPR TGCAGGTCACTCGCGCTTCC CGG (reversed) Intronic